Incidental Mutation 'R4760:Col20a1'
ID 356778
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Name collagen, type XX, alpha 1
Synonyms 1700051I12Rik
MMRRC Submission 041974-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4760 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 180628328-180660156 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 180626196 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029092] [ENSMUST00000108856] [ENSMUST00000108859] [ENSMUST00000108860] [ENSMUST00000108861] [ENSMUST00000108862] [ENSMUST00000185115] [ENSMUST00000149179] [ENSMUST00000184394] [ENSMUST00000228434]
AlphaFold Q923P0
Predicted Effect probably benign
Transcript: ENSMUST00000029092
SMART Domains Protein: ENSMUSP00000029092
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 310 327 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 359 392 N/A INTRINSIC
low complexity region 394 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094214
SMART Domains Protein: ENSMUSP00000091767
Gene: ENSMUSG00000070461

DomainStartEndE-ValueType
low complexity region 107 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108856
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108859
SMART Domains Protein: ENSMUSP00000104487
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108860
SMART Domains Protein: ENSMUSP00000104488
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108861
SMART Domains Protein: ENSMUSP00000104489
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108862
SMART Domains Protein: ENSMUSP00000104490
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148908
Predicted Effect probably benign
Transcript: ENSMUST00000185115
SMART Domains Protein: ENSMUSP00000139222
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 320 337 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
low complexity region 369 402 N/A INTRINSIC
low complexity region 404 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149179
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184394
SMART Domains Protein: ENSMUSP00000138843
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 298 315 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 347 380 N/A INTRINSIC
low complexity region 382 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228434
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530053G22Rik A G 6: 60,379,086 (GRCm39) noncoding transcript Het
Abcc2 A T 19: 43,798,920 (GRCm39) Y512F probably benign Het
Adgrb1 T A 15: 74,443,312 (GRCm39) I51N probably damaging Het
Adhfe1 A G 1: 9,633,748 (GRCm39) Y332C probably damaging Het
Ambn C T 5: 88,615,566 (GRCm39) L317F probably damaging Het
Amn1 T C 6: 149,086,611 (GRCm39) Y17C probably benign Het
Apoa5 T C 9: 46,181,593 (GRCm39) V223A probably damaging Het
Best3 A T 10: 116,860,699 (GRCm39) H653L probably benign Het
Btnl2 C A 17: 34,582,169 (GRCm39) S245Y probably damaging Het
Camk1d A G 2: 5,366,867 (GRCm39) L116P probably damaging Het
Catsperg2 T A 7: 29,405,060 (GRCm39) D698V probably damaging Het
Cd33 T C 7: 43,178,919 (GRCm39) T307A probably benign Het
Cdk8 C T 5: 146,229,476 (GRCm39) S230L probably benign Het
Cfap69 C T 5: 5,696,939 (GRCm39) C119Y probably damaging Het
Chat T C 14: 32,175,694 (GRCm39) N122S probably benign Het
Cyp2j9 A T 4: 96,457,028 (GRCm39) L481Q probably damaging Het
Dab1 A C 4: 104,589,342 (GRCm39) S550R probably damaging Het
Dlgap2 A C 8: 14,823,380 (GRCm39) Q533P probably damaging Het
Eif4g3 A T 4: 137,811,629 (GRCm39) Q31L possibly damaging Het
Ets2 G A 16: 95,520,087 (GRCm39) V438M probably damaging Het
Eva1c G A 16: 90,701,138 (GRCm39) D258N probably benign Het
Fastkd2 A G 1: 63,785,045 (GRCm39) H477R probably benign Het
Fga T G 3: 82,938,821 (GRCm39) S399A probably benign Het
Fmo4 T A 1: 162,637,396 (GRCm39) E32V probably damaging Het
Gm7204 T A 16: 48,039,051 (GRCm39) noncoding transcript Het
Gpi-ps G A 8: 5,690,473 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,286,336 (GRCm39) I548V probably damaging Het
Hsfy2 T C 1: 56,676,349 (GRCm39) T63A probably benign Het
Igf2r A G 17: 12,922,352 (GRCm39) V1254A possibly damaging Het
Ighv8-4 A T 12: 114,987,667 (GRCm39) D110E probably damaging Het
Igkv14-130 T C 6: 67,768,446 (GRCm39) S101P probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ipo5 T C 14: 121,179,054 (GRCm39) V779A probably benign Het
Itpr1 C T 6: 108,326,593 (GRCm39) T105I probably benign Het
Kalrn T C 16: 34,018,857 (GRCm39) M670V probably damaging Het
Kdm8 T A 7: 125,054,431 (GRCm39) probably null Het
Kics2 T C 10: 121,575,912 (GRCm39) V11A probably damaging Het
L3hypdh T C 12: 72,124,016 (GRCm39) I281V probably benign Het
Lins1 T G 7: 66,364,435 (GRCm39) probably benign Het
Map4k5 T A 12: 69,871,372 (GRCm39) I517L possibly damaging Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mlkl C G 8: 112,046,348 (GRCm39) probably null Het
Mllt1 A G 17: 57,209,630 (GRCm39) M160T probably benign Het
Mmp15 G A 8: 96,094,824 (GRCm39) A233T possibly damaging Het
Moxd2 C A 6: 40,868,537 (GRCm39) T23N probably benign Het
Nop53 C A 7: 15,676,812 (GRCm39) K100N probably benign Het
Nrg1 C A 8: 32,408,228 (GRCm39) E2* probably null Het
Or52u1 T A 7: 104,237,696 (GRCm39) H228Q probably benign Het
Pank4 A G 4: 155,059,091 (GRCm39) D408G possibly damaging Het
Pcdhb10 T C 18: 37,544,995 (GRCm39) W24R probably benign Het
Pcm1 C T 8: 41,740,775 (GRCm39) T968I probably damaging Het
Pkib G T 10: 57,584,246 (GRCm39) M19I probably benign Het
Ppy A G 11: 101,991,345 (GRCm39) probably null Het
Pramel21 G A 4: 143,343,801 (GRCm39) R367K probably benign Het
Prdx3 A C 19: 60,861,621 (GRCm39) C39W possibly damaging Het
Qrfpr T G 3: 36,276,073 (GRCm39) N106H probably benign Het
Rai14 G A 15: 10,575,776 (GRCm39) T394M possibly damaging Het
Ralgapa2 A T 2: 146,188,669 (GRCm39) L1371Q probably benign Het
Rbm12 A G 2: 155,939,048 (GRCm39) L408P probably damaging Het
Rdx T C 9: 51,977,174 (GRCm39) I141T probably benign Het
Reep1 T A 6: 71,684,985 (GRCm39) V11E possibly damaging Het
Relch T A 1: 105,649,030 (GRCm39) M723K probably benign Het
Sall4 A G 2: 168,592,347 (GRCm39) S936P probably damaging Het
Serac1 A G 17: 6,102,065 (GRCm39) M403T possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc35g2 T G 9: 100,435,549 (GRCm39) I41L probably benign Het
Slc39a12 G A 2: 14,405,134 (GRCm39) S242N probably benign Het
Slc9a2 T A 1: 40,801,076 (GRCm39) D535E probably damaging Het
Spata31d1a G T 13: 59,849,459 (GRCm39) P890T probably damaging Het
Sync A G 4: 129,187,232 (GRCm39) Q88R probably benign Het
Tdrp A G 8: 14,024,527 (GRCm39) probably benign Het
Tg G T 15: 66,565,168 (GRCm39) C1170F probably damaging Het
Tnks A T 8: 35,318,937 (GRCm39) D781E probably benign Het
Tnp2 T A 16: 10,606,207 (GRCm39) T87S possibly damaging Het
Tpp2 T C 1: 44,010,875 (GRCm39) V554A probably benign Het
Traf3ip2 T C 10: 39,521,735 (GRCm39) I431T probably damaging Het
Trav9d-4 A T 14: 53,221,258 (GRCm39) H84L probably damaging Het
Vmn2r42 T A 7: 8,187,276 (GRCm39) Y782F probably damaging Het
Vwf T C 6: 125,547,567 (GRCm39) S231P probably damaging Het
Wdr83os A G 8: 85,808,496 (GRCm39) S83G probably damaging Het
Wdr91 T A 6: 34,885,234 (GRCm39) Q109L probably damaging Het
Znrf4 A G 17: 56,818,864 (GRCm39) C148R possibly damaging Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 180,645,272 (GRCm39) missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180,634,271 (GRCm39) missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180,641,559 (GRCm39) missense probably damaging 0.99
IGL01388:Col20a1 APN 2 180,645,264 (GRCm39) missense probably benign 0.24
IGL01472:Col20a1 APN 2 180,649,625 (GRCm39) missense probably benign 0.44
IGL01936:Col20a1 APN 2 180,651,161 (GRCm39) splice site probably benign
IGL02133:Col20a1 APN 2 180,648,937 (GRCm39) missense probably damaging 1.00
IGL02318:Col20a1 APN 2 180,648,952 (GRCm39) missense probably damaging 0.99
IGL02576:Col20a1 APN 2 180,655,198 (GRCm39) nonsense probably null
IGL02822:Col20a1 APN 2 180,638,600 (GRCm39) missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180,630,905 (GRCm39) nonsense probably null
IGL03056:Col20a1 APN 2 180,636,682 (GRCm39) missense probably damaging 1.00
IGL03189:Col20a1 APN 2 180,651,200 (GRCm39) nonsense probably null
IGL03196:Col20a1 APN 2 180,649,671 (GRCm39) splice site probably null
R0001:Col20a1 UTSW 2 180,626,205 (GRCm39) unclassified probably benign
R0200:Col20a1 UTSW 2 180,642,231 (GRCm39) missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180,640,955 (GRCm39) missense probably benign 0.00
R0964:Col20a1 UTSW 2 180,626,278 (GRCm39) unclassified probably benign
R0975:Col20a1 UTSW 2 180,648,619 (GRCm39) missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180,641,585 (GRCm39) missense probably benign 0.02
R1395:Col20a1 UTSW 2 180,640,400 (GRCm39) missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180,636,753 (GRCm39) missense probably benign 0.01
R1470:Col20a1 UTSW 2 180,636,753 (GRCm39) missense probably benign 0.01
R1508:Col20a1 UTSW 2 180,634,370 (GRCm39) missense probably damaging 0.98
R1865:Col20a1 UTSW 2 180,657,606 (GRCm39) missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180,634,703 (GRCm39) missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180,634,703 (GRCm39) missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180,640,490 (GRCm39) missense probably benign 0.00
R2020:Col20a1 UTSW 2 180,654,956 (GRCm39) critical splice donor site probably null
R2121:Col20a1 UTSW 2 180,638,249 (GRCm39) missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180,634,366 (GRCm39) missense probably damaging 1.00
R2343:Col20a1 UTSW 2 180,643,124 (GRCm39) missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 180,650,386 (GRCm39) missense probably damaging 1.00
R3430:Col20a1 UTSW 2 180,655,078 (GRCm39) nonsense probably null
R3547:Col20a1 UTSW 2 180,636,704 (GRCm39) missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180,634,242 (GRCm39) missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180,640,285 (GRCm39) missense probably benign 0.00
R4414:Col20a1 UTSW 2 180,643,043 (GRCm39) missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180,634,284 (GRCm39) missense probably damaging 1.00
R4771:Col20a1 UTSW 2 180,630,917 (GRCm39) missense probably benign 0.17
R4809:Col20a1 UTSW 2 180,640,454 (GRCm39) missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180,639,156 (GRCm39) missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 180,648,638 (GRCm39) missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180,640,379 (GRCm39) missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180,628,316 (GRCm39) splice site probably null
R6389:Col20a1 UTSW 2 180,634,376 (GRCm39) splice site probably null
R6422:Col20a1 UTSW 2 180,656,612 (GRCm39) missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180,638,643 (GRCm39) missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180,638,499 (GRCm39) missense probably benign 0.00
R7177:Col20a1 UTSW 2 180,636,007 (GRCm39) nonsense probably null
R7195:Col20a1 UTSW 2 180,649,024 (GRCm39) missense probably damaging 1.00
R7717:Col20a1 UTSW 2 180,649,408 (GRCm39) missense probably damaging 1.00
R7872:Col20a1 UTSW 2 180,628,371 (GRCm39) missense probably benign 0.14
R8183:Col20a1 UTSW 2 180,640,207 (GRCm39) missense
R8188:Col20a1 UTSW 2 180,658,126 (GRCm39) critical splice donor site probably null
R8331:Col20a1 UTSW 2 180,638,559 (GRCm39) missense possibly damaging 0.95
R8423:Col20a1 UTSW 2 180,640,498 (GRCm39) missense probably damaging 1.00
R8803:Col20a1 UTSW 2 180,643,131 (GRCm39) missense possibly damaging 0.75
R8849:Col20a1 UTSW 2 180,640,432 (GRCm39) missense probably damaging 1.00
R8855:Col20a1 UTSW 2 180,655,684 (GRCm39) missense
R8885:Col20a1 UTSW 2 180,640,296 (GRCm39) splice site probably benign
R9160:Col20a1 UTSW 2 180,641,538 (GRCm39) missense probably benign
R9223:Col20a1 UTSW 2 180,648,528 (GRCm39) missense probably damaging 1.00
R9697:Col20a1 UTSW 2 180,641,577 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGCATTTCTAGGTAGCAGG -3'
(R):5'- AGCTCTCGTGATCCATCTTG -3'

Sequencing Primer
(F):5'- CATTTCTAGGTAGCAGGAGGTAG -3'
(R):5'- AGCTCTCGTGATCCATCTTGAAAAC -3'
Posted On 2015-11-11