Incidental Mutation 'R4760:Fga'
ID 356780
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Name fibrinogen alpha chain
Synonyms Fib, ENSMUSG00000059807
MMRRC Submission 041974-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.387) question?
Stock # R4760 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 82933460-82940934 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 82938821 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 399 (S399A)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
AlphaFold E9PV24
Predicted Effect probably benign
Transcript: ENSMUST00000029630
AA Change: S399A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: S399A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166581
AA Change: S399A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: S399A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530053G22Rik A G 6: 60,379,086 (GRCm39) noncoding transcript Het
Abcc2 A T 19: 43,798,920 (GRCm39) Y512F probably benign Het
Adgrb1 T A 15: 74,443,312 (GRCm39) I51N probably damaging Het
Adhfe1 A G 1: 9,633,748 (GRCm39) Y332C probably damaging Het
Ambn C T 5: 88,615,566 (GRCm39) L317F probably damaging Het
Amn1 T C 6: 149,086,611 (GRCm39) Y17C probably benign Het
Apoa5 T C 9: 46,181,593 (GRCm39) V223A probably damaging Het
Best3 A T 10: 116,860,699 (GRCm39) H653L probably benign Het
Btnl2 C A 17: 34,582,169 (GRCm39) S245Y probably damaging Het
Camk1d A G 2: 5,366,867 (GRCm39) L116P probably damaging Het
Catsperg2 T A 7: 29,405,060 (GRCm39) D698V probably damaging Het
Cd33 T C 7: 43,178,919 (GRCm39) T307A probably benign Het
Cdk8 C T 5: 146,229,476 (GRCm39) S230L probably benign Het
Cfap69 C T 5: 5,696,939 (GRCm39) C119Y probably damaging Het
Chat T C 14: 32,175,694 (GRCm39) N122S probably benign Het
Col20a1 A T 2: 180,626,196 (GRCm39) probably benign Het
Cyp2j9 A T 4: 96,457,028 (GRCm39) L481Q probably damaging Het
Dab1 A C 4: 104,589,342 (GRCm39) S550R probably damaging Het
Dlgap2 A C 8: 14,823,380 (GRCm39) Q533P probably damaging Het
Eif4g3 A T 4: 137,811,629 (GRCm39) Q31L possibly damaging Het
Ets2 G A 16: 95,520,087 (GRCm39) V438M probably damaging Het
Eva1c G A 16: 90,701,138 (GRCm39) D258N probably benign Het
Fastkd2 A G 1: 63,785,045 (GRCm39) H477R probably benign Het
Fmo4 T A 1: 162,637,396 (GRCm39) E32V probably damaging Het
Gm7204 T A 16: 48,039,051 (GRCm39) noncoding transcript Het
Gpi-ps G A 8: 5,690,473 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,286,336 (GRCm39) I548V probably damaging Het
Hsfy2 T C 1: 56,676,349 (GRCm39) T63A probably benign Het
Igf2r A G 17: 12,922,352 (GRCm39) V1254A possibly damaging Het
Ighv8-4 A T 12: 114,987,667 (GRCm39) D110E probably damaging Het
Igkv14-130 T C 6: 67,768,446 (GRCm39) S101P probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ipo5 T C 14: 121,179,054 (GRCm39) V779A probably benign Het
Itpr1 C T 6: 108,326,593 (GRCm39) T105I probably benign Het
Kalrn T C 16: 34,018,857 (GRCm39) M670V probably damaging Het
Kdm8 T A 7: 125,054,431 (GRCm39) probably null Het
Kics2 T C 10: 121,575,912 (GRCm39) V11A probably damaging Het
L3hypdh T C 12: 72,124,016 (GRCm39) I281V probably benign Het
Lins1 T G 7: 66,364,435 (GRCm39) probably benign Het
Map4k5 T A 12: 69,871,372 (GRCm39) I517L possibly damaging Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mlkl C G 8: 112,046,348 (GRCm39) probably null Het
Mllt1 A G 17: 57,209,630 (GRCm39) M160T probably benign Het
Mmp15 G A 8: 96,094,824 (GRCm39) A233T possibly damaging Het
Moxd2 C A 6: 40,868,537 (GRCm39) T23N probably benign Het
Nop53 C A 7: 15,676,812 (GRCm39) K100N probably benign Het
Nrg1 C A 8: 32,408,228 (GRCm39) E2* probably null Het
Or52u1 T A 7: 104,237,696 (GRCm39) H228Q probably benign Het
Pank4 A G 4: 155,059,091 (GRCm39) D408G possibly damaging Het
Pcdhb10 T C 18: 37,544,995 (GRCm39) W24R probably benign Het
Pcm1 C T 8: 41,740,775 (GRCm39) T968I probably damaging Het
Pkib G T 10: 57,584,246 (GRCm39) M19I probably benign Het
Ppy A G 11: 101,991,345 (GRCm39) probably null Het
Pramel21 G A 4: 143,343,801 (GRCm39) R367K probably benign Het
Prdx3 A C 19: 60,861,621 (GRCm39) C39W possibly damaging Het
Qrfpr T G 3: 36,276,073 (GRCm39) N106H probably benign Het
Rai14 G A 15: 10,575,776 (GRCm39) T394M possibly damaging Het
Ralgapa2 A T 2: 146,188,669 (GRCm39) L1371Q probably benign Het
Rbm12 A G 2: 155,939,048 (GRCm39) L408P probably damaging Het
Rdx T C 9: 51,977,174 (GRCm39) I141T probably benign Het
Reep1 T A 6: 71,684,985 (GRCm39) V11E possibly damaging Het
Relch T A 1: 105,649,030 (GRCm39) M723K probably benign Het
Sall4 A G 2: 168,592,347 (GRCm39) S936P probably damaging Het
Serac1 A G 17: 6,102,065 (GRCm39) M403T possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc35g2 T G 9: 100,435,549 (GRCm39) I41L probably benign Het
Slc39a12 G A 2: 14,405,134 (GRCm39) S242N probably benign Het
Slc9a2 T A 1: 40,801,076 (GRCm39) D535E probably damaging Het
Spata31d1a G T 13: 59,849,459 (GRCm39) P890T probably damaging Het
Sync A G 4: 129,187,232 (GRCm39) Q88R probably benign Het
Tdrp A G 8: 14,024,527 (GRCm39) probably benign Het
Tg G T 15: 66,565,168 (GRCm39) C1170F probably damaging Het
Tnks A T 8: 35,318,937 (GRCm39) D781E probably benign Het
Tnp2 T A 16: 10,606,207 (GRCm39) T87S possibly damaging Het
Tpp2 T C 1: 44,010,875 (GRCm39) V554A probably benign Het
Traf3ip2 T C 10: 39,521,735 (GRCm39) I431T probably damaging Het
Trav9d-4 A T 14: 53,221,258 (GRCm39) H84L probably damaging Het
Vmn2r42 T A 7: 8,187,276 (GRCm39) Y782F probably damaging Het
Vwf T C 6: 125,547,567 (GRCm39) S231P probably damaging Het
Wdr83os A G 8: 85,808,496 (GRCm39) S83G probably damaging Het
Wdr91 T A 6: 34,885,234 (GRCm39) Q109L probably damaging Het
Znrf4 A G 17: 56,818,864 (GRCm39) C148R possibly damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 82,938,981 (GRCm39) missense probably damaging 1.00
IGL00478:Fga APN 3 82,935,951 (GRCm39) missense probably benign 0.00
IGL00587:Fga APN 3 82,937,596 (GRCm39) missense possibly damaging 0.62
IGL01289:Fga APN 3 82,938,552 (GRCm39) missense possibly damaging 0.85
IGL01323:Fga APN 3 82,937,518 (GRCm39) missense probably damaging 0.99
IGL01369:Fga APN 3 82,937,507 (GRCm39) missense probably benign 0.00
IGL01409:Fga APN 3 82,940,059 (GRCm39) missense probably damaging 1.00
IGL01541:Fga APN 3 82,940,014 (GRCm39) missense probably damaging 1.00
IGL01633:Fga APN 3 82,937,606 (GRCm39) missense possibly damaging 0.89
IGL01966:Fga APN 3 82,936,461 (GRCm39) missense probably damaging 0.97
IGL02651:Fga APN 3 82,935,841 (GRCm39) missense probably benign 0.00
IGL02822:Fga APN 3 82,938,789 (GRCm39) missense probably damaging 1.00
IGL03003:Fga APN 3 82,940,037 (GRCm39) missense probably damaging 1.00
R0336:Fga UTSW 3 82,938,164 (GRCm39) missense probably damaging 1.00
R0540:Fga UTSW 3 82,935,869 (GRCm39) missense probably damaging 1.00
R0607:Fga UTSW 3 82,935,869 (GRCm39) missense probably damaging 1.00
R1471:Fga UTSW 3 82,935,925 (GRCm39) missense probably benign 0.16
R1517:Fga UTSW 3 82,939,145 (GRCm39) missense probably benign 0.00
R1817:Fga UTSW 3 82,939,082 (GRCm39) missense probably benign 0.00
R1874:Fga UTSW 3 82,940,028 (GRCm39) missense probably damaging 1.00
R2014:Fga UTSW 3 82,940,064 (GRCm39) missense probably damaging 0.99
R2267:Fga UTSW 3 82,940,257 (GRCm39) missense probably damaging 1.00
R2332:Fga UTSW 3 82,938,704 (GRCm39) missense probably damaging 1.00
R2420:Fga UTSW 3 82,940,461 (GRCm39) missense possibly damaging 0.53
R2443:Fga UTSW 3 82,935,848 (GRCm39) missense probably benign 0.03
R3978:Fga UTSW 3 82,937,490 (GRCm39) critical splice acceptor site probably null
R4597:Fga UTSW 3 82,938,542 (GRCm39) nonsense probably null
R4644:Fga UTSW 3 82,937,573 (GRCm39) missense possibly damaging 0.81
R4867:Fga UTSW 3 82,935,951 (GRCm39) missense probably benign 0.00
R5449:Fga UTSW 3 82,938,169 (GRCm39) frame shift probably null
R5507:Fga UTSW 3 82,940,643 (GRCm39) missense probably damaging 1.00
R5712:Fga UTSW 3 82,940,440 (GRCm39) missense possibly damaging 0.70
R6853:Fga UTSW 3 82,938,219 (GRCm39) missense probably damaging 1.00
R6865:Fga UTSW 3 82,938,848 (GRCm39) missense probably damaging 1.00
R7163:Fga UTSW 3 82,933,571 (GRCm39) missense probably benign 0.04
R7724:Fga UTSW 3 82,936,432 (GRCm39) missense probably damaging 0.99
R8153:Fga UTSW 3 82,938,164 (GRCm39) missense probably damaging 1.00
R8506:Fga UTSW 3 82,940,623 (GRCm39) missense probably damaging 1.00
R8511:Fga UTSW 3 82,939,064 (GRCm39) nonsense probably null
R8523:Fga UTSW 3 82,938,158 (GRCm39) missense probably damaging 1.00
R8801:Fga UTSW 3 82,938,188 (GRCm39) missense possibly damaging 0.89
R8906:Fga UTSW 3 82,939,111 (GRCm39) missense probably benign 0.12
R9390:Fga UTSW 3 82,940,610 (GRCm39) missense probably damaging 1.00
R9609:Fga UTSW 3 82,940,064 (GRCm39) missense probably damaging 1.00
X0062:Fga UTSW 3 82,937,578 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGGAAATCGGAACCCTGG -3'
(R):5'- CGAGACTGCCGCTAAAACTG -3'

Sequencing Primer
(F):5'- GTCTGATGGCACTGGAGAC -3'
(R):5'- CCGCTAAAACTGTGGGATATGTC -3'
Posted On 2015-11-11