Incidental Mutation 'R4760:Shroom3'
ID 356789
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms Shrm3, D5Ertd287e, Shrm
MMRRC Submission 041974-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4760 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 92831294-93113177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 93090945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530053G22Rik A G 6: 60,379,086 (GRCm39) noncoding transcript Het
Abcc2 A T 19: 43,798,920 (GRCm39) Y512F probably benign Het
Adgrb1 T A 15: 74,443,312 (GRCm39) I51N probably damaging Het
Adhfe1 A G 1: 9,633,748 (GRCm39) Y332C probably damaging Het
Ambn C T 5: 88,615,566 (GRCm39) L317F probably damaging Het
Amn1 T C 6: 149,086,611 (GRCm39) Y17C probably benign Het
Apoa5 T C 9: 46,181,593 (GRCm39) V223A probably damaging Het
Best3 A T 10: 116,860,699 (GRCm39) H653L probably benign Het
Btnl2 C A 17: 34,582,169 (GRCm39) S245Y probably damaging Het
Camk1d A G 2: 5,366,867 (GRCm39) L116P probably damaging Het
Catsperg2 T A 7: 29,405,060 (GRCm39) D698V probably damaging Het
Cd33 T C 7: 43,178,919 (GRCm39) T307A probably benign Het
Cdk8 C T 5: 146,229,476 (GRCm39) S230L probably benign Het
Cfap69 C T 5: 5,696,939 (GRCm39) C119Y probably damaging Het
Chat T C 14: 32,175,694 (GRCm39) N122S probably benign Het
Col20a1 A T 2: 180,626,196 (GRCm39) probably benign Het
Cyp2j9 A T 4: 96,457,028 (GRCm39) L481Q probably damaging Het
Dab1 A C 4: 104,589,342 (GRCm39) S550R probably damaging Het
Dlgap2 A C 8: 14,823,380 (GRCm39) Q533P probably damaging Het
Eif4g3 A T 4: 137,811,629 (GRCm39) Q31L possibly damaging Het
Ets2 G A 16: 95,520,087 (GRCm39) V438M probably damaging Het
Eva1c G A 16: 90,701,138 (GRCm39) D258N probably benign Het
Fastkd2 A G 1: 63,785,045 (GRCm39) H477R probably benign Het
Fga T G 3: 82,938,821 (GRCm39) S399A probably benign Het
Fmo4 T A 1: 162,637,396 (GRCm39) E32V probably damaging Het
Gm7204 T A 16: 48,039,051 (GRCm39) noncoding transcript Het
Gpi-ps G A 8: 5,690,473 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,286,336 (GRCm39) I548V probably damaging Het
Hsfy2 T C 1: 56,676,349 (GRCm39) T63A probably benign Het
Igf2r A G 17: 12,922,352 (GRCm39) V1254A possibly damaging Het
Ighv8-4 A T 12: 114,987,667 (GRCm39) D110E probably damaging Het
Igkv14-130 T C 6: 67,768,446 (GRCm39) S101P probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ipo5 T C 14: 121,179,054 (GRCm39) V779A probably benign Het
Itpr1 C T 6: 108,326,593 (GRCm39) T105I probably benign Het
Kalrn T C 16: 34,018,857 (GRCm39) M670V probably damaging Het
Kdm8 T A 7: 125,054,431 (GRCm39) probably null Het
Kics2 T C 10: 121,575,912 (GRCm39) V11A probably damaging Het
L3hypdh T C 12: 72,124,016 (GRCm39) I281V probably benign Het
Lins1 T G 7: 66,364,435 (GRCm39) probably benign Het
Map4k5 T A 12: 69,871,372 (GRCm39) I517L possibly damaging Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mlkl C G 8: 112,046,348 (GRCm39) probably null Het
Mllt1 A G 17: 57,209,630 (GRCm39) M160T probably benign Het
Mmp15 G A 8: 96,094,824 (GRCm39) A233T possibly damaging Het
Moxd2 C A 6: 40,868,537 (GRCm39) T23N probably benign Het
Nop53 C A 7: 15,676,812 (GRCm39) K100N probably benign Het
Nrg1 C A 8: 32,408,228 (GRCm39) E2* probably null Het
Or52u1 T A 7: 104,237,696 (GRCm39) H228Q probably benign Het
Pank4 A G 4: 155,059,091 (GRCm39) D408G possibly damaging Het
Pcdhb10 T C 18: 37,544,995 (GRCm39) W24R probably benign Het
Pcm1 C T 8: 41,740,775 (GRCm39) T968I probably damaging Het
Pkib G T 10: 57,584,246 (GRCm39) M19I probably benign Het
Ppy A G 11: 101,991,345 (GRCm39) probably null Het
Pramel21 G A 4: 143,343,801 (GRCm39) R367K probably benign Het
Prdx3 A C 19: 60,861,621 (GRCm39) C39W possibly damaging Het
Qrfpr T G 3: 36,276,073 (GRCm39) N106H probably benign Het
Rai14 G A 15: 10,575,776 (GRCm39) T394M possibly damaging Het
Ralgapa2 A T 2: 146,188,669 (GRCm39) L1371Q probably benign Het
Rbm12 A G 2: 155,939,048 (GRCm39) L408P probably damaging Het
Rdx T C 9: 51,977,174 (GRCm39) I141T probably benign Het
Reep1 T A 6: 71,684,985 (GRCm39) V11E possibly damaging Het
Relch T A 1: 105,649,030 (GRCm39) M723K probably benign Het
Sall4 A G 2: 168,592,347 (GRCm39) S936P probably damaging Het
Serac1 A G 17: 6,102,065 (GRCm39) M403T possibly damaging Het
Slc35g2 T G 9: 100,435,549 (GRCm39) I41L probably benign Het
Slc39a12 G A 2: 14,405,134 (GRCm39) S242N probably benign Het
Slc9a2 T A 1: 40,801,076 (GRCm39) D535E probably damaging Het
Spata31d1a G T 13: 59,849,459 (GRCm39) P890T probably damaging Het
Sync A G 4: 129,187,232 (GRCm39) Q88R probably benign Het
Tdrp A G 8: 14,024,527 (GRCm39) probably benign Het
Tg G T 15: 66,565,168 (GRCm39) C1170F probably damaging Het
Tnks A T 8: 35,318,937 (GRCm39) D781E probably benign Het
Tnp2 T A 16: 10,606,207 (GRCm39) T87S possibly damaging Het
Tpp2 T C 1: 44,010,875 (GRCm39) V554A probably benign Het
Traf3ip2 T C 10: 39,521,735 (GRCm39) I431T probably damaging Het
Trav9d-4 A T 14: 53,221,258 (GRCm39) H84L probably damaging Het
Vmn2r42 T A 7: 8,187,276 (GRCm39) Y782F probably damaging Het
Vwf T C 6: 125,547,567 (GRCm39) S231P probably damaging Het
Wdr83os A G 8: 85,808,496 (GRCm39) S83G probably damaging Het
Wdr91 T A 6: 34,885,234 (GRCm39) Q109L probably damaging Het
Znrf4 A G 17: 56,818,864 (GRCm39) C148R possibly damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 93,098,924 (GRCm39) missense probably damaging 1.00
IGL01086:Shroom3 APN 5 93,096,311 (GRCm39) missense probably benign 0.01
IGL01363:Shroom3 APN 5 93,088,852 (GRCm39) missense probably benign 0.01
IGL01468:Shroom3 APN 5 93,088,201 (GRCm39) missense probably damaging 1.00
IGL01675:Shroom3 APN 5 93,089,539 (GRCm39) missense probably damaging 0.99
IGL01862:Shroom3 APN 5 93,110,148 (GRCm39) missense probably damaging 1.00
IGL01987:Shroom3 APN 5 93,090,048 (GRCm39) missense probably damaging 0.99
IGL02104:Shroom3 APN 5 93,088,248 (GRCm39) missense probably benign 0.32
IGL03248:Shroom3 APN 5 93,100,399 (GRCm39) missense probably benign 0.00
IGL03386:Shroom3 APN 5 93,096,342 (GRCm39) splice site probably benign
R0167:Shroom3 UTSW 5 93,096,254 (GRCm39) splice site probably benign
R0388:Shroom3 UTSW 5 93,099,152 (GRCm39) missense probably benign 0.39
R0395:Shroom3 UTSW 5 92,928,762 (GRCm39) missense probably damaging 1.00
R0567:Shroom3 UTSW 5 93,112,312 (GRCm39) missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 93,090,693 (GRCm39) missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 93,088,515 (GRCm39) missense probably damaging 0.97
R1845:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R1921:Shroom3 UTSW 5 93,110,224 (GRCm39) critical splice donor site probably null
R2059:Shroom3 UTSW 5 92,831,643 (GRCm39) missense probably damaging 1.00
R2203:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2301:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2344:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2345:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2346:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2348:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92,928,729 (GRCm39) missense probably damaging 1.00
R2435:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2829:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2830:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2831:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2897:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2898:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3080:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3433:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3729:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3730:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3735:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3852:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3943:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3969:Shroom3 UTSW 5 93,088,738 (GRCm39) missense probably benign 0.05
R4008:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4009:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4012:Shroom3 UTSW 5 93,096,342 (GRCm39) splice site probably benign
R4154:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4157:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4172:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4173:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4201:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4202:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4206:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4284:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4285:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4364:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4384:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4456:Shroom3 UTSW 5 93,088,858 (GRCm39) missense probably benign 0.14
R4707:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4712:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4751:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4755:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4773:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4774:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4776:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4801:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4802:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4856:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4857:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4882:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4883:Shroom3 UTSW 5 93,098,993 (GRCm39) missense probably benign 0.14
R4886:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R5262:Shroom3 UTSW 5 93,112,432 (GRCm39) missense probably damaging 1.00
R5271:Shroom3 UTSW 5 93,110,107 (GRCm39) missense probably damaging 1.00
R5719:Shroom3 UTSW 5 93,090,877 (GRCm39) missense probably benign 0.04
R5726:Shroom3 UTSW 5 93,090,864 (GRCm39) missense probably benign 0.00
R5993:Shroom3 UTSW 5 93,088,047 (GRCm39) missense probably damaging 1.00
R6078:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6138:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6153:Shroom3 UTSW 5 93,112,267 (GRCm39) missense probably damaging 0.99
R6493:Shroom3 UTSW 5 93,089,420 (GRCm39) missense probably benign 0.03
R6495:Shroom3 UTSW 5 93,089,928 (GRCm39) missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 93,088,617 (GRCm39) missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 93,088,795 (GRCm39) missense probably damaging 1.00
R6893:Shroom3 UTSW 5 93,090,063 (GRCm39) missense probably damaging 0.97
R6912:Shroom3 UTSW 5 93,090,876 (GRCm39) missense probably benign 0.02
R6924:Shroom3 UTSW 5 93,112,262 (GRCm39) missense probably damaging 1.00
R7083:Shroom3 UTSW 5 93,112,384 (GRCm39) missense probably damaging 1.00
R7197:Shroom3 UTSW 5 93,090,463 (GRCm39) missense probably damaging 1.00
R7366:Shroom3 UTSW 5 93,112,465 (GRCm39) nonsense probably null
R7712:Shroom3 UTSW 5 93,098,806 (GRCm39) missense probably benign 0.01
R7725:Shroom3 UTSW 5 93,089,512 (GRCm39) missense probably benign 0.19
R7728:Shroom3 UTSW 5 92,831,566 (GRCm39) missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 93,098,348 (GRCm39) missense probably damaging 0.98
R7795:Shroom3 UTSW 5 93,067,508 (GRCm39) missense probably damaging 0.99
R7821:Shroom3 UTSW 5 93,088,705 (GRCm39) missense probably damaging 0.98
R7971:Shroom3 UTSW 5 93,098,933 (GRCm39) missense probably damaging 1.00
R8276:Shroom3 UTSW 5 93,088,339 (GRCm39) missense probably damaging 0.99
R8934:Shroom3 UTSW 5 93,089,584 (GRCm39) missense probably damaging 1.00
R8938:Shroom3 UTSW 5 93,090,930 (GRCm39) missense probably damaging 1.00
R9083:Shroom3 UTSW 5 93,098,533 (GRCm39) missense probably damaging 0.97
R9108:Shroom3 UTSW 5 93,087,975 (GRCm39) missense probably damaging 1.00
R9124:Shroom3 UTSW 5 93,112,401 (GRCm39) missense probably benign 0.19
R9295:Shroom3 UTSW 5 93,098,478 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- TCTTAACTGTCAGAACGGTAACCAAC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'
Posted On 2015-11-11