Mutagenetix > Incidental Mutation

Incidental Mutation 'R4760:Vwf'

356797

Institutional Source

Beutler Lab

Gene Symbol

Vwf

Ensembl Gene

ENSMUSG00000001930

Gene Name

Von Willebrand factor

Synonyms

6820430P06Rik, B130011O06Rik

MMRRC Submission

041974-MU

Accession Numbers

Genbank: NM_011708; MGI: 98941

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R4760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125546774-125686679 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125570604 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 231 (S231P)

Ref Sequence

ENSEMBL: ENSMUSP00000098502 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100941] [ENSMUST00000112253] [ENSMUST00000112254]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000100941
AA Change: S231P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098502
Gene: ENSMUSG00000001930
AA Change: S231P

Domain	Start	End	E-Value	Type
VWD	38	196	3.43e-35	SMART
C8	236	310	1.11e-21	SMART
Pfam:TIL	313	366	2.8e-15	PFAM
Blast:VWC	368	404	6e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112253
AA Change: S216P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107872
Gene: ENSMUSG00000001930
AA Change: S216P

Domain	Start	End	E-Value	Type
VWD	23	181	3.43e-35	SMART
C8	221	295	1.11e-21	SMART
Pfam:TIL	298	351	2.7e-15	PFAM
Blast:VWC	353	389	6e-18	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112254
AA Change: S213P

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: S213P

Domain	Start	End	E-Value	Type
VWD	23	181	3.43e-35	SMART
C8	221	295	1.11e-21	SMART
Pfam:TIL	298	351	6.9e-15	PFAM
VWC	353	413	8.71e-1	SMART
VWD	380	543	2.93e-52	SMART
C8	580	652	3.82e-25	SMART
Pfam:TIL	655	710	4.1e-14	PFAM
EGF_like	790	825	4.37e1	SMART
VWC	832	901	3.29e-3	SMART
VWD	859	1015	5.15e-39	SMART
C8	1056	1130	1.01e-33	SMART
Pfam:TIL	1144	1199	1.3e-9	PFAM
VWA	1278	1461	1.81e-20	SMART
low complexity region	1464	1477	N/A	INTRINSIC
VWA	1499	1672	8.43e-39	SMART
VWA	1692	1875	2.83e-31	SMART
VWC	1882	1949	2.99e0	SMART
VWD	1941	2104	5.03e-42	SMART
C8	2135	2203	1.29e-13	SMART
Pfam:TIL	2206	2257	8.3e-8	PFAM
VWC	2260	2328	3.16e-16	SMART
low complexity region	2417	2428	N/A	INTRINSIC
VWC	2434	2497	2.61e-17	SMART
VWC	2513	2577	3.37e0	SMART
VWC	2585	2647	2.55e-11	SMART
CT	2730	2815	1.37e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126709

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150548

Meta Mutation Damage Score

0.2730

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,721,305	M723K	probably benign	Het
A530053G22Rik	A	G	6: 60,402,101		noncoding transcript	Het
Abcc2	A	T	19: 43,810,481	Y512F	probably benign	Het
Adgrb1	T	A	15: 74,571,463	I51N	probably damaging	Het
Adhfe1	A	G	1: 9,563,523	Y332C	probably damaging	Het
Ambn	C	T	5: 88,467,707	L317F	probably damaging	Het
Amn1	T	C	6: 149,185,113	Y17C	probably benign	Het
Apoa5	T	C	9: 46,270,295	V223A	probably damaging	Het
BC048403	T	C	10: 121,740,007	V11A	probably damaging	Het
Best3	A	T	10: 117,024,794	H653L	probably benign	Het
Btnl2	C	A	17: 34,363,195	S245Y	probably damaging	Het
Camk1d	A	G	2: 5,362,056	L116P	probably damaging	Het
Catsperg2	T	A	7: 29,705,635	D698V	probably damaging	Het
Cd33	T	C	7: 43,529,495	T307A	probably benign	Het
Cdk8	C	T	5: 146,292,666	S230L	probably benign	Het
Cfap69	C	T	5: 5,646,939	C119Y	probably damaging	Het
Chat	T	C	14: 32,453,737	N122S	probably benign	Het
Col20a1	A	T	2: 180,984,403		probably benign	Het
Cyp2j9	A	T	4: 96,568,791	L481Q	probably damaging	Het
Dab1	A	C	4: 104,732,145	S550R	probably damaging	Het
Dlgap2	A	C	8: 14,773,380	Q533P	probably damaging	Het
Eif4g3	A	T	4: 138,084,318	Q31L	possibly damaging	Het
Ets2	G	A	16: 95,719,043	V438M	probably damaging	Het
Eva1c	G	A	16: 90,904,250	D258N	probably benign	Het
Fastkd2	A	G	1: 63,745,886	H477R	probably benign	Het
Fga	T	G	3: 83,031,514	S399A	probably benign	Het
Fmo4	T	A	1: 162,809,827	E32V	probably damaging	Het
Gm13083	G	A	4: 143,617,231	R367K	probably benign	Het
Gm1840	G	A	8: 5,640,473		noncoding transcript	Het
Gm7204	T	A	16: 48,218,688		noncoding transcript	Het
Hhipl1	A	G	12: 108,320,077	I548V	probably damaging	Het
Hsfy2	T	C	1: 56,637,190	T63A	probably benign	Het
Igf2r	A	G	17: 12,703,465	V1254A	possibly damaging	Het
Ighv8-4	A	T	12: 115,024,047	D110E	probably damaging	Het
Igkv14-130	T	C	6: 67,791,462	S101P	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Ipo5	T	C	14: 120,941,642	V779A	probably benign	Het
Itpr1	C	T	6: 108,349,632	T105I	probably benign	Het
Kalrn	T	C	16: 34,198,487	M670V	probably damaging	Het
Kdm8	T	A	7: 125,455,259		probably null	Het
L3hypdh	T	C	12: 72,077,242	I281V	probably benign	Het
Lins1	T	G	7: 66,714,687		probably benign	Het
Map4k5	T	A	12: 69,824,598	I517L	possibly damaging	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mlkl	C	G	8: 111,319,716		probably null	Het
Mllt1	A	G	17: 56,902,630	M160T	probably benign	Het
Mmp15	G	A	8: 95,368,196	A233T	possibly damaging	Het
Moxd2	C	A	6: 40,891,603	T23N	probably benign	Het
Nop53	C	A	7: 15,942,887	K100N	probably benign	Het
Nrg1	C	A	8: 31,918,200	E2*	probably null	Het
Olfr654	T	A	7: 104,588,489	H228Q	probably benign	Het
Pank4	A	G	4: 154,974,634	D408G	possibly damaging	Het
Pcdhb10	T	C	18: 37,411,942	W24R	probably benign	Het
Pcm1	C	T	8: 41,287,738	T968I	probably damaging	Het
Pkib	G	T	10: 57,708,150	M19I	probably benign	Het
Ppy	A	G	11: 102,100,519		probably null	Het
Prdx3	A	C	19: 60,873,183	C39W	possibly damaging	Het
Qrfpr	T	G	3: 36,221,924	N106H	probably benign	Het
Rai14	G	A	15: 10,575,690	T394M	possibly damaging	Het
Ralgapa2	A	T	2: 146,346,749	L1371Q	probably benign	Het
Rbm12	A	G	2: 156,097,128	L408P	probably damaging	Het
Rdx	T	C	9: 52,065,874	I141T	probably benign	Het
Reep1	T	A	6: 71,708,001	V11E	possibly damaging	Het
Sall4	A	G	2: 168,750,427	S936P	probably damaging	Het
Serac1	A	G	17: 6,051,790	M403T	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc35g2	T	G	9: 100,553,496	I41L	probably benign	Het
Slc39a12	G	A	2: 14,400,323	S242N	probably benign	Het
Slc9a2	T	A	1: 40,761,916	D535E	probably damaging	Het
Spata31d1a	G	T	13: 59,701,645	P890T	probably damaging	Het
Sync	A	G	4: 129,293,439	Q88R	probably benign	Het
Tdrp	A	G	8: 13,974,527		probably benign	Het
Tg	G	T	15: 66,693,319	C1170F	probably damaging	Het
Tnks	A	T	8: 34,851,783	D781E	probably benign	Het
Tnp2	T	A	16: 10,788,343	T87S	possibly damaging	Het
Tpp2	T	C	1: 43,971,715	V554A	probably benign	Het
Traf3ip2	T	C	10: 39,645,739	I431T	probably damaging	Het
Trav9d-4	A	T	14: 52,983,801	H84L	probably damaging	Het
Vmn2r42	T	A	7: 8,184,277	Y782F	probably damaging	Het
Wdr83os	A	G	8: 85,081,867	S83G	probably damaging	Het
Wdr91	T	A	6: 34,908,299	Q109L	probably damaging	Het
Znrf4	A	G	17: 56,511,864	C148R	possibly damaging	Het

Other mutations in Vwf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Vwf	APN	6	125658872	missense	unknown
IGL00561:Vwf	APN	6	125642721	missense	possibly damaging	0.88
IGL01104:Vwf	APN	6	125683556	missense	probably damaging	1.00
IGL01404:Vwf	APN	6	125677970	missense	probably damaging	1.00
IGL01539:Vwf	APN	6	125590262	missense	possibly damaging	0.85
IGL01550:Vwf	APN	6	125679289	missense	probably benign	0.00
IGL01563:Vwf	APN	6	125591165	missense	probably damaging	1.00
IGL01637:Vwf	APN	6	125645736	missense	probably damaging	1.00
IGL01720:Vwf	APN	6	125642835	missense	possibly damaging	0.69
IGL01834:Vwf	APN	6	125590170	splice site	probably benign
IGL02103:Vwf	APN	6	125646355	missense	probably damaging	1.00
IGL02120:Vwf	APN	6	125616034	missense	probably benign	0.26
IGL02174:Vwf	APN	6	125555395	missense	probably damaging	1.00
IGL02203:Vwf	APN	6	125642406	missense	probably damaging	1.00
IGL02420:Vwf	APN	6	125677916	missense	probably benign	0.00
IGL02723:Vwf	APN	6	125642930	missense	possibly damaging	0.85
IGL02818:Vwf	APN	6	125663548	missense	probably benign
IGL02931:Vwf	APN	6	125615968	missense	possibly damaging	0.68
IGL03015:Vwf	APN	6	125684138	splice site	probably benign
IGL03038:Vwf	APN	6	125604157	missense	possibly damaging	0.92
IGL03060:Vwf	APN	6	125663560	missense	probably damaging	1.00
IGL03114:Vwf	APN	6	125599363	nonsense	probably null
IGL03266:Vwf	APN	6	125678077	splice site	probably benign
gingerman	UTSW	6	125662963	critical splice acceptor site	probably null
R0605_vwf_644	UTSW	6	125685837	missense	probably benign	0.02
R1575_Vwf_091	UTSW	6	125663571	nonsense	probably null
R1628_Vwf_608	UTSW	6	125647738	unclassified	probably benign
R1669_Vwf_448	UTSW	6	125647906	missense	possibly damaging	0.92
R1833_Vwf_948	UTSW	6	125642037	missense	probably benign	0.14
R2130_vwf_946	UTSW	6	125657057	missense	probably damaging	1.00
R6360_Vwf_065	UTSW	6	125683526	missense	probably benign	0.13
R7900_Vwf_938	UTSW	6	125628476	critical splice donor site	probably null
Russiahouse	UTSW	6	125639341	nonsense	probably null
B5639:Vwf	UTSW	6	125642984	missense	probably damaging	1.00
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0087:Vwf	UTSW	6	125645954	missense	probably benign	0.03
R0194:Vwf	UTSW	6	125643297	missense	probably benign
R0206:Vwf	UTSW	6	125637456	missense	probably damaging	1.00
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0390:Vwf	UTSW	6	125626361	nonsense	probably null
R0427:Vwf	UTSW	6	125673939	missense	probably benign
R0437:Vwf	UTSW	6	125566318	missense	probably damaging	1.00
R0470:Vwf	UTSW	6	125628428	missense	possibly damaging	0.70
R0499:Vwf	UTSW	6	125638114	missense	probably benign	0.10
R0554:Vwf	UTSW	6	125642781	missense	probably benign	0.13
R0605:Vwf	UTSW	6	125685837	missense	probably benign	0.02
R0711:Vwf	UTSW	6	125626271	missense	probably benign	0.01
R0723:Vwf	UTSW	6	125566262	missense	probably benign	0.01
R0973:Vwf	UTSW	6	125643006	missense	probably damaging	1.00
R1054:Vwf	UTSW	6	125590227	missense	probably damaging	1.00
R1115:Vwf	UTSW	6	125655065	missense	unknown
R1156:Vwf	UTSW	6	125637488	missense	probably damaging	1.00
R1191:Vwf	UTSW	6	125599252	missense	probably damaging	1.00
R1240:Vwf	UTSW	6	125603308	splice site	probably null
R1398:Vwf	UTSW	6	125603457	missense	probably benign	0.02
R1435:Vwf	UTSW	6	125642249	nonsense	probably null
R1528:Vwf	UTSW	6	125608291	missense	possibly damaging	0.69
R1575:Vwf	UTSW	6	125655251	missense	unknown
R1575:Vwf	UTSW	6	125663571	nonsense	probably null
R1628:Vwf	UTSW	6	125647738	unclassified	probably benign
R1669:Vwf	UTSW	6	125647906	missense	possibly damaging	0.92
R1699:Vwf	UTSW	6	125643069	missense	probably damaging	1.00
R1699:Vwf	UTSW	6	125685900	missense	possibly damaging	0.74
R1725:Vwf	UTSW	6	125646282	missense	probably benign	0.05
R1742:Vwf	UTSW	6	125667550	missense	probably benign	0.02
R1809:Vwf	UTSW	6	125590175	splice site	probably benign
R1833:Vwf	UTSW	6	125642037	missense	probably benign	0.14
R1866:Vwf	UTSW	6	125667529	missense	possibly damaging	0.62
R1870:Vwf	UTSW	6	125642939	missense	probably damaging	1.00
R1874:Vwf	UTSW	6	125628372	missense	probably benign	0.00
R1941:Vwf	UTSW	6	125639279	missense	possibly damaging	0.64
R2061:Vwf	UTSW	6	125591188	missense	probably damaging	0.98
R2103:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2104:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2130:Vwf	UTSW	6	125657057	missense	probably damaging	1.00
R2159:Vwf	UTSW	6	125626341	missense	probably damaging	0.99
R2178:Vwf	UTSW	6	125642132	missense	possibly damaging	0.90
R2656:Vwf	UTSW	6	125555361	missense	probably benign	0.00
R2913:Vwf	UTSW	6	125685846	missense	probably benign	0.08
R2917:Vwf	UTSW	6	125608143	missense	probably benign	0.07
R3726:Vwf	UTSW	6	125677948	utr 3 prime	probably benign
R3735:Vwf	UTSW	6	125588613	missense	probably damaging	1.00
R3774:Vwf	UTSW	6	125649099	splice site	probably null
R3934:Vwf	UTSW	6	125555499	missense	probably damaging	1.00
R4291:Vwf	UTSW	6	125642322	missense	probably damaging	1.00
R4384:Vwf	UTSW	6	125655116	missense	unknown
R4743:Vwf	UTSW	6	125684091	critical splice acceptor site	probably null
R4776:Vwf	UTSW	6	125566305	missense	possibly damaging	0.53
R4791:Vwf	UTSW	6	125643363	missense
R4871:Vwf	UTSW	6	125686462	missense	probably benign	0.25
R4894:Vwf	UTSW	6	125645934	nonsense	probably null
R4963:Vwf	UTSW	6	125667483	nonsense	probably null
R5010:Vwf	UTSW	6	125566257	missense	probably benign	0.15
R5289:Vwf	UTSW	6	125667510	utr 3 prime	probably benign
R5512:Vwf	UTSW	6	125673887	utr 3 prime	probably benign
R5523:Vwf	UTSW	6	125643042	missense
R5642:Vwf	UTSW	6	125603418	missense
R5860:Vwf	UTSW	6	125643090	missense
R5860:Vwf	UTSW	6	125679265	utr 3 prime	probably benign
R5896:Vwf	UTSW	6	125678762	critical splice acceptor site	probably null
R5926:Vwf	UTSW	6	125604174	missense	probably damaging	1.00
R5976:Vwf	UTSW	6	125603463	missense
R6053:Vwf	UTSW	6	125600665	missense	probably benign	0.21
R6151:Vwf	UTSW	6	125657065	missense	unknown
R6179:Vwf	UTSW	6	125649289	missense	unknown
R6181:Vwf	UTSW	6	125566146	missense	probably damaging	0.98
R6234:Vwf	UTSW	6	125657165	missense	unknown
R6360:Vwf	UTSW	6	125683526	missense	probably benign	0.13
R6412:Vwf	UTSW	6	125679316	missense	probably benign	0.00
R6464:Vwf	UTSW	6	125639400	critical splice donor site	probably null
R6522:Vwf	UTSW	6	125662963	critical splice acceptor site	probably null
R6766:Vwf	UTSW	6	125639376	missense	unknown
R6856:Vwf	UTSW	6	125642150	nonsense	probably null
R6877:Vwf	UTSW	6	125657201	missense	possibly damaging	0.48
R6896:Vwf	UTSW	6	125566194	missense	probably damaging	1.00
R7113:Vwf	UTSW	6	125655044	missense
R7287:Vwf	UTSW	6	125637467	missense
R7359:Vwf	UTSW	6	125566257	missense
R7509:Vwf	UTSW	6	125642169	missense
R7519:Vwf	UTSW	6	125667543	missense
R7545:Vwf	UTSW	6	125614097	missense
R7549:Vwf	UTSW	6	125626267	missense
R7593:Vwf	UTSW	6	125647768	missense
R7635:Vwf	UTSW	6	125682734	missense
R7793:Vwf	UTSW	6	125686520	missense
R7802:Vwf	UTSW	6	125666677	missense
R7824:Vwf	UTSW	6	125658815	missense
R7849:Vwf	UTSW	6	125656803	missense
R7900:Vwf	UTSW	6	125628476	critical splice donor site	probably null
R7919:Vwf	UTSW	6	125647859	missense
R7966:Vwf	UTSW	6	125639341	nonsense	probably null
R8101:Vwf	UTSW	6	125570559	nonsense	probably null
R8162:Vwf	UTSW	6	125645836	splice site	probably null
R8345:Vwf	UTSW	6	125679302	missense
R8853:Vwf	UTSW	6	125657264	missense
R9027:Vwf	UTSW	6	125666663	missense
R9065:Vwf	UTSW	6	125646299	missense
R9068:Vwf	UTSW	6	125648829	unclassified	probably benign
R9128:Vwf	UTSW	6	125642730	missense
R9136:Vwf	UTSW	6	125599393	splice site	probably benign
R9164:Vwf	UTSW	6	125565843	missense
R9177:Vwf	UTSW	6	125604291	missense
R9334:Vwf	UTSW	6	125677946	missense
R9508:Vwf	UTSW	6	125555508	missense
R9553:Vwf	UTSW	6	125600699	missense
R9660:Vwf	UTSW	6	125591707	missense	possibly damaging	0.61
R9706:Vwf	UTSW	6	125624573	missense
R9708:Vwf	UTSW	6	125657090	missense
R9712:Vwf	UTSW	6	125624573	missense
R9714:Vwf	UTSW	6	125624573	missense
R9728:Vwf	UTSW	6	125591707	missense	possibly damaging	0.61
R9758:Vwf	UTSW	6	125626267	missense
X0021:Vwf	UTSW	6	125646331	missense	probably damaging	1.00
X0065:Vwf	UTSW	6	125603433	missense	probably null	0.05
Z1176:Vwf	UTSW	6	125591231	missense
Z1176:Vwf	UTSW	6	125603308	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TCATGCGGAGGTCTTGGTAC -3'
(R):5'- CCAGTTTTAAAGAAAGCACAAGGCC -3'

Sequencing Primer
(F):5'- TCTTGGTACAGGCTTAACTGAAG -3'
(R):5'- CACAAGGCCAAGGAAAATATTAGAAC -3'

Posted On

2015-11-11