Incidental Mutation 'R0403:Kif1b'
ID 35680
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Name kinesin family member 1B
Synonyms Kif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission 038608-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0403 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 149176319-149307693 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 149181967 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 389 (K389*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]
AlphaFold Q60575
Predicted Effect probably null
Transcript: ENSMUST00000055647
AA Change: K1665*
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: K1665*

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060537
AA Change: K1711*
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: K1711*

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139123
AA Change: K389*
SMART Domains Protein: ENSMUSP00000120076
Gene: ENSMUSG00000063077
AA Change: K389*

DomainStartEndE-ValueType
Pfam:DUF3694 1 92 4.4e-23 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 204 232 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
PH 381 480 1.02e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150853
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,973,880 (GRCm38) probably null Het
Adgrg3 C T 8: 95,036,922 (GRCm38) L284F probably benign Het
Alkbh8 T A 9: 3,385,469 (GRCm38) V587E probably damaging Het
Ap4b1 T A 3: 103,818,839 (GRCm38) C244S probably damaging Het
Ap4b1 T A 3: 103,821,396 (GRCm38) M590K probably benign Het
Arhgap15 C T 2: 44,063,766 (GRCm38) T168I probably damaging Het
Atp8b1 A G 18: 64,540,310 (GRCm38) V997A probably damaging Het
Atrn G A 2: 130,906,859 (GRCm38) C100Y probably damaging Het
Baiap2l2 C A 15: 79,271,216 (GRCm38) A151S probably benign Het
Baz2b A T 2: 59,969,377 (GRCm38) D199E possibly damaging Het
Bmal2 T A 6: 146,822,655 (GRCm38) H348Q probably damaging Het
Cblb A G 16: 52,152,626 (GRCm38) D440G probably benign Het
Cdon T C 9: 35,473,500 (GRCm38) V694A probably benign Het
Cep250 A T 2: 155,992,349 (GRCm38) R2065W probably damaging Het
Ces2b G T 8: 104,833,945 (GRCm38) A131S probably damaging Het
Chrna9 A T 5: 65,967,892 (GRCm38) T59S possibly damaging Het
Cog3 T A 14: 75,742,327 (GRCm38) probably benign Het
Cpa1 G A 6: 30,641,857 (GRCm38) V227I probably benign Het
Cyp3a25 A T 5: 145,998,513 (GRCm38) C98S probably damaging Het
D8Ertd738e C T 8: 84,249,601 (GRCm38) probably null Het
Ddx60 A G 8: 61,994,541 (GRCm38) probably benign Het
Dhx16 T C 17: 35,883,050 (GRCm38) probably null Het
Dnah9 T A 11: 66,084,789 (GRCm38) Q1478L possibly damaging Het
Dock10 T C 1: 80,524,070 (GRCm38) Y1434C possibly damaging Het
Enpp3 T A 10: 24,804,436 (GRCm38) D325V probably damaging Het
Entpd6 C A 2: 150,760,170 (GRCm38) T194K possibly damaging Het
Fat2 A T 11: 55,270,349 (GRCm38) V3185E probably benign Het
Flrt1 A G 19: 7,095,919 (GRCm38) L421P probably benign Het
Fmn2 A T 1: 174,694,278 (GRCm38) Q1292L probably damaging Het
Fndc1 T C 17: 7,753,723 (GRCm38) D1459G probably damaging Het
Fndc1 T C 17: 7,775,588 (GRCm38) probably null Het
Fzr1 A G 10: 81,369,368 (GRCm38) S265P possibly damaging Het
Gpr142 G A 11: 114,806,029 (GRCm38) V134M probably damaging Het
Grid2ip G T 5: 143,357,620 (GRCm38) V24L possibly damaging Het
Herc2 G A 7: 56,159,417 (GRCm38) R2555H probably damaging Het
Hpdl A T 4: 116,820,479 (GRCm38) Y262N possibly damaging Het
Htr3a A G 9: 48,908,659 (GRCm38) V57A probably damaging Het
Igfbp7 T C 5: 77,355,591 (GRCm38) I186V probably benign Het
Itga2b C T 11: 102,467,326 (GRCm38) probably null Het
Itgae A C 11: 73,123,183 (GRCm38) D736A possibly damaging Het
Itpkc T A 7: 27,208,345 (GRCm38) M645L probably benign Het
Jchain T C 5: 88,521,378 (GRCm38) R139G probably benign Het
Kif13a A G 13: 46,791,401 (GRCm38) V908A probably damaging Het
Klhl12 T C 1: 134,485,856 (GRCm38) Y360H possibly damaging Het
Knop1 G A 7: 118,853,053 (GRCm38) R148W probably damaging Het
Lpar1 T A 4: 58,487,191 (GRCm38) N27Y probably damaging Het
Lpar2 T A 8: 69,824,152 (GRCm38) V197D probably damaging Het
Lrrc74a A G 12: 86,740,979 (GRCm38) N128S probably damaging Het
Lum G T 10: 97,572,043 (GRCm38) V337F probably benign Het
Mag T C 7: 30,906,980 (GRCm38) D344G probably damaging Het
Maip1 G A 1: 57,407,196 (GRCm38) A142T probably benign Het
Mlh3 A G 12: 85,268,968 (GRCm38) V148A possibly damaging Het
Nav3 A G 10: 109,767,103 (GRCm38) V1195A probably damaging Het
Ncor2 A G 5: 125,033,337 (GRCm38) S868P possibly damaging Het
Nek1 A G 8: 61,106,855 (GRCm38) E907G probably damaging Het
Nfam1 G A 15: 83,016,379 (GRCm38) T134I probably benign Het
Nr0b2 T C 4: 133,553,759 (GRCm38) V112A probably damaging Het
Nrp1 A G 8: 128,457,969 (GRCm38) N365S probably damaging Het
Nrsn2 T C 2: 152,369,790 (GRCm38) Y107C probably damaging Het
Ntng1 G A 3: 109,934,611 (GRCm38) A282V probably damaging Het
Nxf1 T C 19: 8,765,028 (GRCm38) I337T probably damaging Het
Obscn C T 11: 59,076,540 (GRCm38) G479D probably damaging Het
Oprd1 T A 4: 132,113,768 (GRCm38) D293V probably benign Het
Or13a17 T C 7: 140,691,309 (GRCm38) S135P possibly damaging Het
P3h2 T G 16: 25,969,950 (GRCm38) N586H possibly damaging Het
Pcid2 T C 8: 13,085,367 (GRCm38) Y214C probably damaging Het
Pkd1l3 C G 8: 109,623,649 (GRCm38) D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 (GRCm38) S380N probably benign Het
Ppic C A 18: 53,411,071 (GRCm38) G81W probably damaging Het
Ppp2r1a C A 17: 20,957,041 (GRCm38) P246T probably damaging Het
Ppp4r4 T G 12: 103,584,102 (GRCm38) S46A probably benign Het
Pramel31 A G 4: 144,362,646 (GRCm38) N178S probably benign Het
Prkce A G 17: 86,168,653 (GRCm38) T21A probably damaging Het
Prkg2 T C 5: 98,994,645 (GRCm38) E210G possibly damaging Het
Prss35 A G 9: 86,756,037 (GRCm38) M287V probably damaging Het
Psd G A 19: 46,320,972 (GRCm38) probably benign Het
Ptch2 A T 4: 117,110,839 (GRCm38) K843* probably null Het
Rab44 C A 17: 29,145,261 (GRCm38) T603K probably damaging Het
Rasal3 T A 17: 32,392,790 (GRCm38) probably null Het
Rbbp6 A G 7: 122,992,296 (GRCm38) T526A probably damaging Het
Ros1 A T 10: 52,143,438 (GRCm38) probably benign Het
Sec24b A G 3: 129,999,534 (GRCm38) S685P probably damaging Het
Sec24b T A 3: 129,989,676 (GRCm38) L1104F possibly damaging Het
Sema6a G A 18: 47,290,045 (GRCm38) probably null Het
Setmar A T 6: 108,075,962 (GRCm38) H139L probably benign Het
Slc28a2b T C 2: 122,521,854 (GRCm38) L364S probably damaging Het
Slc4a7 T C 14: 14,766,808 (GRCm38) V710A probably benign Het
Smarcc1 T A 9: 110,237,808 (GRCm38) probably null Het
Smchd1 G A 17: 71,394,902 (GRCm38) L1032F probably damaging Het
Speg T C 1: 75,430,784 (GRCm38) probably benign Het
Tasor2 A T 13: 3,582,052 (GRCm38) Y816* probably null Het
Tcea1 C G 1: 4,889,503 (GRCm38) R134G probably benign Het
Tchhl1 C T 3: 93,471,029 (GRCm38) Q347* probably null Het
Tecrl A T 5: 83,354,758 (GRCm38) probably benign Het
Tepsin T C 11: 120,093,682 (GRCm38) probably benign Het
Tmem40 G A 6: 115,733,985 (GRCm38) probably benign Het
Tpr G A 1: 150,407,414 (GRCm38) probably benign Het
Ttll12 A T 15: 83,580,658 (GRCm38) probably benign Het
Ttn T A 2: 76,909,608 (GRCm38) D3529V probably benign Het
Usp34 T A 11: 23,333,838 (GRCm38) H177Q possibly damaging Het
Vsig10 T A 5: 117,338,461 (GRCm38) S327T probably benign Het
Zbtb4 T A 11: 69,777,639 (GRCm38) M396K probably damaging Het
Zfp352 C T 4: 90,225,009 (GRCm38) T462I possibly damaging Het
Zfp385b T C 2: 77,476,845 (GRCm38) M145V probably damaging Het
Zfp780b C A 7: 27,971,689 (GRCm38) V65F possibly damaging Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149,220,602 (GRCm38) missense probably damaging 1.00
IGL01943:Kif1b APN 4 149,214,905 (GRCm38) critical splice donor site probably null
IGL02240:Kif1b APN 4 149,246,414 (GRCm38) missense probably damaging 1.00
IGL02414:Kif1b APN 4 149,199,314 (GRCm38) missense probably damaging 0.96
IGL02490:Kif1b APN 4 149,204,208 (GRCm38) missense probably benign
IGL02501:Kif1b APN 4 149,214,976 (GRCm38) missense probably damaging 1.00
IGL02833:Kif1b APN 4 149,246,364 (GRCm38) missense probably damaging 1.00
IGL02852:Kif1b APN 4 149,291,328 (GRCm38) missense probably damaging 1.00
IGL02900:Kif1b APN 4 149,180,809 (GRCm38) missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149,214,981 (GRCm38) missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149,274,939 (GRCm38) missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149,220,792 (GRCm38) critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149,181,927 (GRCm38) missense probably damaging 1.00
R0044:Kif1b UTSW 4 149,263,601 (GRCm38) splice site probably benign
R0044:Kif1b UTSW 4 149,263,601 (GRCm38) splice site probably benign
R0129:Kif1b UTSW 4 149,261,201 (GRCm38) missense probably benign
R0180:Kif1b UTSW 4 149,213,659 (GRCm38) missense probably damaging 1.00
R0288:Kif1b UTSW 4 149,199,338 (GRCm38) missense probably damaging 1.00
R0360:Kif1b UTSW 4 149,262,729 (GRCm38) missense probably damaging 1.00
R0383:Kif1b UTSW 4 149,202,512 (GRCm38) missense probably damaging 1.00
R0398:Kif1b UTSW 4 149,204,231 (GRCm38) missense possibly damaging 0.89
R0445:Kif1b UTSW 4 149,188,009 (GRCm38) missense probably benign 0.01
R1466:Kif1b UTSW 4 149,223,252 (GRCm38) missense probably damaging 0.99
R1466:Kif1b UTSW 4 149,223,252 (GRCm38) missense probably damaging 0.99
R1681:Kif1b UTSW 4 149,195,501 (GRCm38) critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149,187,722 (GRCm38) missense probably damaging 0.99
R1840:Kif1b UTSW 4 149,188,132 (GRCm38) missense probably damaging 1.00
R1874:Kif1b UTSW 4 149,187,632 (GRCm38) missense probably benign
R1915:Kif1b UTSW 4 149,267,216 (GRCm38) missense probably damaging 1.00
R2106:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149,222,296 (GRCm38) missense probably benign 0.08
R2126:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149,184,309 (GRCm38) missense probably damaging 0.99
R2255:Kif1b UTSW 4 149,274,997 (GRCm38) missense probably damaging 1.00
R2392:Kif1b UTSW 4 149,220,620 (GRCm38) missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149,237,648 (GRCm38) missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149,220,541 (GRCm38) critical splice donor site probably null
R3038:Kif1b UTSW 4 149,213,333 (GRCm38) missense probably benign 0.02
R3616:Kif1b UTSW 4 149,262,283 (GRCm38) splice site probably benign
R3935:Kif1b UTSW 4 149,237,160 (GRCm38) missense probably benign 0.00
R4347:Kif1b UTSW 4 149,247,234 (GRCm38) missense probably damaging 1.00
R4423:Kif1b UTSW 4 149,214,105 (GRCm38) missense probably damaging 0.99
R4637:Kif1b UTSW 4 149,199,311 (GRCm38) missense probably damaging 0.97
R4745:Kif1b UTSW 4 149,237,882 (GRCm38) nonsense probably null
R4807:Kif1b UTSW 4 149,247,921 (GRCm38) intron probably benign
R5618:Kif1b UTSW 4 149,269,889 (GRCm38) missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149,238,482 (GRCm38) missense probably damaging 0.96
R5683:Kif1b UTSW 4 149,222,261 (GRCm38) missense probably damaging 1.00
R5696:Kif1b UTSW 4 149,273,849 (GRCm38) splice site probably null
R6022:Kif1b UTSW 4 149,198,532 (GRCm38) missense probably benign 0.01
R6048:Kif1b UTSW 4 149,263,629 (GRCm38) missense probably damaging 1.00
R6137:Kif1b UTSW 4 149,238,426 (GRCm38) missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149,237,532 (GRCm38) missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149,258,048 (GRCm38) missense probably damaging 1.00
R6250:Kif1b UTSW 4 149,213,643 (GRCm38) missense probably benign 0.00
R6423:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6424:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6425:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6443:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6460:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6462:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6463:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6469:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6470:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6471:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6472:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6504:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6536:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6537:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6668:Kif1b UTSW 4 149,213,407 (GRCm38) missense probably benign 0.09
R6698:Kif1b UTSW 4 149,274,956 (GRCm38) missense probably damaging 0.99
R7065:Kif1b UTSW 4 149,202,525 (GRCm38) missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149,225,157 (GRCm38) missense probably damaging 1.00
R7342:Kif1b UTSW 4 149,214,090 (GRCm38) missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149,182,355 (GRCm38) missense probably benign 0.01
R7744:Kif1b UTSW 4 149,237,075 (GRCm38) missense possibly damaging 0.83
R7797:Kif1b UTSW 4 149,237,387 (GRCm38) missense probably benign
R7829:Kif1b UTSW 4 149,220,990 (GRCm38) splice site probably null
R7869:Kif1b UTSW 4 149,184,376 (GRCm38) missense probably benign 0.01
R7878:Kif1b UTSW 4 149,214,997 (GRCm38) missense probably damaging 0.98
R7980:Kif1b UTSW 4 149,269,921 (GRCm38) missense probably damaging 1.00
R8047:Kif1b UTSW 4 149,214,922 (GRCm38) missense probably damaging 1.00
R8237:Kif1b UTSW 4 149,191,185 (GRCm38) missense probably benign 0.10
R8243:Kif1b UTSW 4 149,204,267 (GRCm38) missense probably benign
R8252:Kif1b UTSW 4 149,273,805 (GRCm38) missense probably damaging 1.00
R8342:Kif1b UTSW 4 149,222,348 (GRCm38) missense probably damaging 0.96
R8460:Kif1b UTSW 4 149,187,620 (GRCm38) missense possibly damaging 0.93
R8462:Kif1b UTSW 4 149,182,340 (GRCm38) missense probably benign 0.05
R8496:Kif1b UTSW 4 149,192,611 (GRCm38) nonsense probably null
R8687:Kif1b UTSW 4 149,261,163 (GRCm38) nonsense probably null
R8694:Kif1b UTSW 4 149,220,567 (GRCm38) missense probably damaging 0.98
R8842:Kif1b UTSW 4 149,253,739 (GRCm38) missense probably damaging 0.98
R8883:Kif1b UTSW 4 149,276,885 (GRCm38) missense probably benign
R8971:Kif1b UTSW 4 149,247,816 (GRCm38) missense probably damaging 1.00
R8994:Kif1b UTSW 4 149,195,482 (GRCm38) missense
R9002:Kif1b UTSW 4 149,191,255 (GRCm38) missense probably damaging 0.96
R9227:Kif1b UTSW 4 149,237,900 (GRCm38) missense probably damaging 1.00
R9231:Kif1b UTSW 4 149,191,195 (GRCm38) missense possibly damaging 0.94
R9450:Kif1b UTSW 4 149,238,010 (GRCm38) missense probably benign 0.01
R9478:Kif1b UTSW 4 149,261,159 (GRCm38) critical splice donor site probably null
R9571:Kif1b UTSW 4 149,220,641 (GRCm38) missense probably damaging 1.00
R9644:Kif1b UTSW 4 149,291,379 (GRCm38) missense probably damaging 1.00
RF008:Kif1b UTSW 4 149,251,738 (GRCm38) splice site probably null
X0009:Kif1b UTSW 4 149,247,264 (GRCm38) missense probably damaging 1.00
X0062:Kif1b UTSW 4 149,275,005 (GRCm38) missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149,266,298 (GRCm38) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCACTTCACACCGAAAGTTCATGC -3'
(R):5'- GTGACCAGTGATGATCTAGGCCAAC -3'

Sequencing Primer
(F):5'- TTCATGCAACCCAGATATAAACTAGG -3'
(R):5'- AGGCCAACTGGATCATTTTCC -3'
Posted On 2013-05-09