Incidental Mutation 'R4760:Tnks'
ID356809
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
SynonymsmTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission 041974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4760 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location34826460-34965690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34851783 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 781 (D781E)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
PDB Structure
Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033929
AA Change: D781E

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: D781E

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209904
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,721,305 M723K probably benign Het
A530053G22Rik A G 6: 60,402,101 noncoding transcript Het
Abcc2 A T 19: 43,810,481 Y512F probably benign Het
Adgrb1 T A 15: 74,571,463 I51N probably damaging Het
Adhfe1 A G 1: 9,563,523 Y332C probably damaging Het
Ambn C T 5: 88,467,707 L317F probably damaging Het
Amn1 T C 6: 149,185,113 Y17C probably benign Het
Apoa5 T C 9: 46,270,295 V223A probably damaging Het
BC048403 T C 10: 121,740,007 V11A probably damaging Het
Best3 A T 10: 117,024,794 H653L probably benign Het
Btnl2 C A 17: 34,363,195 S245Y probably damaging Het
Camk1d A G 2: 5,362,056 L116P probably damaging Het
Catsperg2 T A 7: 29,705,635 D698V probably damaging Het
Cd33 T C 7: 43,529,495 T307A probably benign Het
Cdk8 C T 5: 146,292,666 S230L probably benign Het
Cfap69 C T 5: 5,646,939 C119Y probably damaging Het
Chat T C 14: 32,453,737 N122S probably benign Het
Col20a1 A T 2: 180,984,403 probably benign Het
Cyp2j9 A T 4: 96,568,791 L481Q probably damaging Het
Dab1 A C 4: 104,732,145 S550R probably damaging Het
Dlgap2 A C 8: 14,773,380 Q533P probably damaging Het
Eif4g3 A T 4: 138,084,318 Q31L possibly damaging Het
Ets2 G A 16: 95,719,043 V438M probably damaging Het
Eva1c G A 16: 90,904,250 D258N probably benign Het
Fastkd2 A G 1: 63,745,886 H477R probably benign Het
Fga T G 3: 83,031,514 S399A probably benign Het
Fmo4 T A 1: 162,809,827 E32V probably damaging Het
Gm13083 G A 4: 143,617,231 R367K probably benign Het
Gm1840 G A 8: 5,640,473 noncoding transcript Het
Gm7204 T A 16: 48,218,688 noncoding transcript Het
Hhipl1 A G 12: 108,320,077 I548V probably damaging Het
Hsfy2 T C 1: 56,637,190 T63A probably benign Het
Igf2r A G 17: 12,703,465 V1254A possibly damaging Het
Ighv8-4 A T 12: 115,024,047 D110E probably damaging Het
Igkv14-130 T C 6: 67,791,462 S101P probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Ipo5 T C 14: 120,941,642 V779A probably benign Het
Itpr1 C T 6: 108,349,632 T105I probably benign Het
Kalrn T C 16: 34,198,487 M670V probably damaging Het
Kdm8 T A 7: 125,455,259 probably null Het
L3hypdh T C 12: 72,077,242 I281V probably benign Het
Lins1 T G 7: 66,714,687 probably benign Het
Map4k5 T A 12: 69,824,598 I517L possibly damaging Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mlkl C G 8: 111,319,716 probably null Het
Mllt1 A G 17: 56,902,630 M160T probably benign Het
Mmp15 G A 8: 95,368,196 A233T possibly damaging Het
Moxd2 C A 6: 40,891,603 T23N probably benign Het
Nop53 C A 7: 15,942,887 K100N probably benign Het
Nrg1 C A 8: 31,918,200 E2* probably null Het
Olfr654 T A 7: 104,588,489 H228Q probably benign Het
Pank4 A G 4: 154,974,634 D408G possibly damaging Het
Pcdhb10 T C 18: 37,411,942 W24R probably benign Het
Pcm1 C T 8: 41,287,738 T968I probably damaging Het
Pkib G T 10: 57,708,150 M19I probably benign Het
Ppy A G 11: 102,100,519 probably null Het
Prdx3 A C 19: 60,873,183 C39W possibly damaging Het
Qrfpr T G 3: 36,221,924 N106H probably benign Het
Rai14 G A 15: 10,575,690 T394M possibly damaging Het
Ralgapa2 A T 2: 146,346,749 L1371Q probably benign Het
Rbm12 A G 2: 156,097,128 L408P probably damaging Het
Rdx T C 9: 52,065,874 I141T probably benign Het
Reep1 T A 6: 71,708,001 V11E possibly damaging Het
Sall4 A G 2: 168,750,427 S936P probably damaging Het
Serac1 A G 17: 6,051,790 M403T possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc35g2 T G 9: 100,553,496 I41L probably benign Het
Slc39a12 G A 2: 14,400,323 S242N probably benign Het
Slc9a2 T A 1: 40,761,916 D535E probably damaging Het
Spata31d1a G T 13: 59,701,645 P890T probably damaging Het
Sync A G 4: 129,293,439 Q88R probably benign Het
Tdrp A G 8: 13,974,527 probably benign Het
Tg G T 15: 66,693,319 C1170F probably damaging Het
Tnp2 T A 16: 10,788,343 T87S possibly damaging Het
Tpp2 T C 1: 43,971,715 V554A probably benign Het
Traf3ip2 T C 10: 39,645,739 I431T probably damaging Het
Trav9d-4 A T 14: 52,983,801 H84L probably damaging Het
Vmn2r42 T A 7: 8,184,277 Y782F probably damaging Het
Vwf T C 6: 125,570,604 S231P probably damaging Het
Wdr83os A G 8: 85,081,867 S83G probably damaging Het
Wdr91 T A 6: 34,908,299 Q109L probably damaging Het
Znrf4 A G 17: 56,511,864 C148R possibly damaging Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGACACTTACCTGCCAGG -3'
(R):5'- CAAAAGTTCCCCAGTATCCTCTG -3'

Sequencing Primer
(F):5'- CAGGTGGAGAGGGGTTGAATTTC -3'
(R):5'- TAGGTTTCCTTCCAGCTG -3'
Posted On2015-11-11