Incidental Mutation 'R4760:Apoa5'
ID 356814
Institutional Source Beutler Lab
Gene Symbol Apoa5
Ensembl Gene ENSMUSG00000032079
Gene Name apolipoprotein A-V
Synonyms 1300007O05Rik, RAP3, Apoav
MMRRC Submission 041974-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4760 (G1)
Quality Score 219
Status Validated
Chromosome 9
Chromosomal Location 46179931-46183217 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46181593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 223 (V223A)
Ref Sequence ENSEMBL: ENSMUSP00000113413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000215187] [ENSMUST00000213878] [ENSMUST00000215458] [ENSMUST00000214202]
AlphaFold Q8C7G5
Predicted Effect probably damaging
Transcript: ENSMUST00000034584
AA Change: V223A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079
AA Change: V223A

DomainStartEndE-ValueType
Pfam:Apolipoprotein 52 264 5.1e-59 PFAM
Pfam:Apolipoprotein 258 315 1.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114552
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121598
AA Change: V223A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079
AA Change: V223A

DomainStartEndE-ValueType
Pfam:Apolipoprotein 51 305 8.1e-66 PFAM
low complexity region 312 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125239
SMART Domains Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Blast:Zpr1 33 59 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141763
Predicted Effect probably benign
Transcript: ENSMUST00000156440
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215484
Predicted Effect probably benign
Transcript: ENSMUST00000215187
Predicted Effect probably benign
Transcript: ENSMUST00000213878
Predicted Effect probably benign
Transcript: ENSMUST00000215458
Predicted Effect probably benign
Transcript: ENSMUST00000214202
Meta Mutation Damage Score 0.5421 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased triglyceride and VLDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530053G22Rik A G 6: 60,379,086 (GRCm39) noncoding transcript Het
Abcc2 A T 19: 43,798,920 (GRCm39) Y512F probably benign Het
Adgrb1 T A 15: 74,443,312 (GRCm39) I51N probably damaging Het
Adhfe1 A G 1: 9,633,748 (GRCm39) Y332C probably damaging Het
Ambn C T 5: 88,615,566 (GRCm39) L317F probably damaging Het
Amn1 T C 6: 149,086,611 (GRCm39) Y17C probably benign Het
Best3 A T 10: 116,860,699 (GRCm39) H653L probably benign Het
Btnl2 C A 17: 34,582,169 (GRCm39) S245Y probably damaging Het
Camk1d A G 2: 5,366,867 (GRCm39) L116P probably damaging Het
Catsperg2 T A 7: 29,405,060 (GRCm39) D698V probably damaging Het
Cd33 T C 7: 43,178,919 (GRCm39) T307A probably benign Het
Cdk8 C T 5: 146,229,476 (GRCm39) S230L probably benign Het
Cfap69 C T 5: 5,696,939 (GRCm39) C119Y probably damaging Het
Chat T C 14: 32,175,694 (GRCm39) N122S probably benign Het
Col20a1 A T 2: 180,626,196 (GRCm39) probably benign Het
Cyp2j9 A T 4: 96,457,028 (GRCm39) L481Q probably damaging Het
Dab1 A C 4: 104,589,342 (GRCm39) S550R probably damaging Het
Dlgap2 A C 8: 14,823,380 (GRCm39) Q533P probably damaging Het
Eif4g3 A T 4: 137,811,629 (GRCm39) Q31L possibly damaging Het
Ets2 G A 16: 95,520,087 (GRCm39) V438M probably damaging Het
Eva1c G A 16: 90,701,138 (GRCm39) D258N probably benign Het
Fastkd2 A G 1: 63,785,045 (GRCm39) H477R probably benign Het
Fga T G 3: 82,938,821 (GRCm39) S399A probably benign Het
Fmo4 T A 1: 162,637,396 (GRCm39) E32V probably damaging Het
Gm7204 T A 16: 48,039,051 (GRCm39) noncoding transcript Het
Gpi-ps G A 8: 5,690,473 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,286,336 (GRCm39) I548V probably damaging Het
Hsfy2 T C 1: 56,676,349 (GRCm39) T63A probably benign Het
Igf2r A G 17: 12,922,352 (GRCm39) V1254A possibly damaging Het
Ighv8-4 A T 12: 114,987,667 (GRCm39) D110E probably damaging Het
Igkv14-130 T C 6: 67,768,446 (GRCm39) S101P probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ipo5 T C 14: 121,179,054 (GRCm39) V779A probably benign Het
Itpr1 C T 6: 108,326,593 (GRCm39) T105I probably benign Het
Kalrn T C 16: 34,018,857 (GRCm39) M670V probably damaging Het
Kdm8 T A 7: 125,054,431 (GRCm39) probably null Het
Kics2 T C 10: 121,575,912 (GRCm39) V11A probably damaging Het
L3hypdh T C 12: 72,124,016 (GRCm39) I281V probably benign Het
Lins1 T G 7: 66,364,435 (GRCm39) probably benign Het
Map4k5 T A 12: 69,871,372 (GRCm39) I517L possibly damaging Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mlkl C G 8: 112,046,348 (GRCm39) probably null Het
Mllt1 A G 17: 57,209,630 (GRCm39) M160T probably benign Het
Mmp15 G A 8: 96,094,824 (GRCm39) A233T possibly damaging Het
Moxd2 C A 6: 40,868,537 (GRCm39) T23N probably benign Het
Nop53 C A 7: 15,676,812 (GRCm39) K100N probably benign Het
Nrg1 C A 8: 32,408,228 (GRCm39) E2* probably null Het
Or52u1 T A 7: 104,237,696 (GRCm39) H228Q probably benign Het
Pank4 A G 4: 155,059,091 (GRCm39) D408G possibly damaging Het
Pcdhb10 T C 18: 37,544,995 (GRCm39) W24R probably benign Het
Pcm1 C T 8: 41,740,775 (GRCm39) T968I probably damaging Het
Pkib G T 10: 57,584,246 (GRCm39) M19I probably benign Het
Ppy A G 11: 101,991,345 (GRCm39) probably null Het
Pramel21 G A 4: 143,343,801 (GRCm39) R367K probably benign Het
Prdx3 A C 19: 60,861,621 (GRCm39) C39W possibly damaging Het
Qrfpr T G 3: 36,276,073 (GRCm39) N106H probably benign Het
Rai14 G A 15: 10,575,776 (GRCm39) T394M possibly damaging Het
Ralgapa2 A T 2: 146,188,669 (GRCm39) L1371Q probably benign Het
Rbm12 A G 2: 155,939,048 (GRCm39) L408P probably damaging Het
Rdx T C 9: 51,977,174 (GRCm39) I141T probably benign Het
Reep1 T A 6: 71,684,985 (GRCm39) V11E possibly damaging Het
Relch T A 1: 105,649,030 (GRCm39) M723K probably benign Het
Sall4 A G 2: 168,592,347 (GRCm39) S936P probably damaging Het
Serac1 A G 17: 6,102,065 (GRCm39) M403T possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc35g2 T G 9: 100,435,549 (GRCm39) I41L probably benign Het
Slc39a12 G A 2: 14,405,134 (GRCm39) S242N probably benign Het
Slc9a2 T A 1: 40,801,076 (GRCm39) D535E probably damaging Het
Spata31d1a G T 13: 59,849,459 (GRCm39) P890T probably damaging Het
Sync A G 4: 129,187,232 (GRCm39) Q88R probably benign Het
Tdrp A G 8: 14,024,527 (GRCm39) probably benign Het
Tg G T 15: 66,565,168 (GRCm39) C1170F probably damaging Het
Tnks A T 8: 35,318,937 (GRCm39) D781E probably benign Het
Tnp2 T A 16: 10,606,207 (GRCm39) T87S possibly damaging Het
Tpp2 T C 1: 44,010,875 (GRCm39) V554A probably benign Het
Traf3ip2 T C 10: 39,521,735 (GRCm39) I431T probably damaging Het
Trav9d-4 A T 14: 53,221,258 (GRCm39) H84L probably damaging Het
Vmn2r42 T A 7: 8,187,276 (GRCm39) Y782F probably damaging Het
Vwf T C 6: 125,547,567 (GRCm39) S231P probably damaging Het
Wdr83os A G 8: 85,808,496 (GRCm39) S83G probably damaging Het
Wdr91 T A 6: 34,885,234 (GRCm39) Q109L probably damaging Het
Znrf4 A G 17: 56,818,864 (GRCm39) C148R possibly damaging Het
Other mutations in Apoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Apoa5 APN 9 46,181,950 (GRCm39) missense probably damaging 0.98
IGL02089:Apoa5 APN 9 46,180,437 (GRCm39) critical splice donor site probably null
R0046:Apoa5 UTSW 9 46,181,296 (GRCm39) missense probably damaging 1.00
R1722:Apoa5 UTSW 9 46,181,847 (GRCm39) nonsense probably null
R2007:Apoa5 UTSW 9 46,181,665 (GRCm39) missense possibly damaging 0.95
R2356:Apoa5 UTSW 9 46,181,341 (GRCm39) missense probably damaging 0.98
R3739:Apoa5 UTSW 9 46,180,415 (GRCm39) missense probably damaging 1.00
R3835:Apoa5 UTSW 9 46,181,878 (GRCm39) missense probably damaging 1.00
R4364:Apoa5 UTSW 9 46,181,827 (GRCm39) missense probably damaging 1.00
R4657:Apoa5 UTSW 9 46,181,170 (GRCm39) missense probably benign 0.12
R5160:Apoa5 UTSW 9 46,181,794 (GRCm39) missense probably damaging 0.99
R5523:Apoa5 UTSW 9 46,181,887 (GRCm39) missense possibly damaging 0.79
R5915:Apoa5 UTSW 9 46,180,607 (GRCm39) missense probably damaging 1.00
R6106:Apoa5 UTSW 9 46,181,931 (GRCm39) nonsense probably null
R6849:Apoa5 UTSW 9 46,181,298 (GRCm39) missense probably benign 0.03
R7170:Apoa5 UTSW 9 46,181,437 (GRCm39) missense probably benign 0.00
R9268:Apoa5 UTSW 9 46,181,719 (GRCm39) missense probably benign 0.18
R9403:Apoa5 UTSW 9 46,181,944 (GRCm39) missense probably damaging 1.00
R9495:Apoa5 UTSW 9 46,181,944 (GRCm39) missense probably damaging 1.00
R9499:Apoa5 UTSW 9 46,181,944 (GRCm39) missense probably damaging 1.00
Z1177:Apoa5 UTSW 9 46,180,417 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGTTGAAACCCTACACGGC -3'
(R):5'- AAAAGCCTGCAGTCTCTGG -3'

Sequencing Primer
(F):5'- ACCAAGGCTCAGCTCCTG -3'
(R):5'- TGCAGTCTCTGGCGGAC -3'
Posted On 2015-11-11