Incidental Mutation 'R4760:Pkib'
ID 356819
Institutional Source Beutler Lab
Gene Symbol Pkib
Ensembl Gene ENSMUSG00000019876
Gene Name protein kinase inhibitor beta, cAMP dependent, testis specific
Synonyms PKIbeta, Prkacn2
MMRRC Submission 041974-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4760 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 57508077-57617208 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 57584246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 19 (M19I)
Ref Sequence ENSEMBL: ENSMUSP00000093329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066028] [ENSMUST00000075992] [ENSMUST00000095668] [ENSMUST00000175852] [ENSMUST00000177325] [ENSMUST00000177438] [ENSMUST00000177473]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000066028
SMART Domains Protein: ENSMUSP00000067532
Gene: ENSMUSG00000019876

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075992
SMART Domains Protein: ENSMUSP00000075374
Gene: ENSMUSG00000019876

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095668
AA Change: M19I

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093329
Gene: ENSMUSG00000019876
AA Change: M19I

DomainStartEndE-ValueType
Pfam:PKI 41 109 1.8e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175852
SMART Domains Protein: ENSMUSP00000135666
Gene: ENSMUSG00000019876

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177299
Predicted Effect probably benign
Transcript: ENSMUST00000177325
SMART Domains Protein: ENSMUSP00000135280
Gene: ENSMUSG00000019876

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177438
Predicted Effect probably benign
Transcript: ENSMUST00000177473
SMART Domains Protein: ENSMUSP00000135835
Gene: ENSMUSG00000019876

DomainStartEndE-ValueType
Pfam:PKI 9 78 3.3e-33 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cAMP-dependent protein kinase inhibitor family. The encoded protein may play a role in the protein kinase A (PKA) pathway by interacting with the catalytic subunit of PKA, and overexpression of this gene may play a role in prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced protein kinase inhibitor activity in the testis but are phenotypically normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530053G22Rik A G 6: 60,379,086 (GRCm39) noncoding transcript Het
Abcc2 A T 19: 43,798,920 (GRCm39) Y512F probably benign Het
Adgrb1 T A 15: 74,443,312 (GRCm39) I51N probably damaging Het
Adhfe1 A G 1: 9,633,748 (GRCm39) Y332C probably damaging Het
Ambn C T 5: 88,615,566 (GRCm39) L317F probably damaging Het
Amn1 T C 6: 149,086,611 (GRCm39) Y17C probably benign Het
Apoa5 T C 9: 46,181,593 (GRCm39) V223A probably damaging Het
Best3 A T 10: 116,860,699 (GRCm39) H653L probably benign Het
Btnl2 C A 17: 34,582,169 (GRCm39) S245Y probably damaging Het
Camk1d A G 2: 5,366,867 (GRCm39) L116P probably damaging Het
Catsperg2 T A 7: 29,405,060 (GRCm39) D698V probably damaging Het
Cd33 T C 7: 43,178,919 (GRCm39) T307A probably benign Het
Cdk8 C T 5: 146,229,476 (GRCm39) S230L probably benign Het
Cfap69 C T 5: 5,696,939 (GRCm39) C119Y probably damaging Het
Chat T C 14: 32,175,694 (GRCm39) N122S probably benign Het
Col20a1 A T 2: 180,626,196 (GRCm39) probably benign Het
Cyp2j9 A T 4: 96,457,028 (GRCm39) L481Q probably damaging Het
Dab1 A C 4: 104,589,342 (GRCm39) S550R probably damaging Het
Dlgap2 A C 8: 14,823,380 (GRCm39) Q533P probably damaging Het
Eif4g3 A T 4: 137,811,629 (GRCm39) Q31L possibly damaging Het
Ets2 G A 16: 95,520,087 (GRCm39) V438M probably damaging Het
Eva1c G A 16: 90,701,138 (GRCm39) D258N probably benign Het
Fastkd2 A G 1: 63,785,045 (GRCm39) H477R probably benign Het
Fga T G 3: 82,938,821 (GRCm39) S399A probably benign Het
Fmo4 T A 1: 162,637,396 (GRCm39) E32V probably damaging Het
Gm7204 T A 16: 48,039,051 (GRCm39) noncoding transcript Het
Gpi-ps G A 8: 5,690,473 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,286,336 (GRCm39) I548V probably damaging Het
Hsfy2 T C 1: 56,676,349 (GRCm39) T63A probably benign Het
Igf2r A G 17: 12,922,352 (GRCm39) V1254A possibly damaging Het
Ighv8-4 A T 12: 114,987,667 (GRCm39) D110E probably damaging Het
Igkv14-130 T C 6: 67,768,446 (GRCm39) S101P probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ipo5 T C 14: 121,179,054 (GRCm39) V779A probably benign Het
Itpr1 C T 6: 108,326,593 (GRCm39) T105I probably benign Het
Kalrn T C 16: 34,018,857 (GRCm39) M670V probably damaging Het
Kdm8 T A 7: 125,054,431 (GRCm39) probably null Het
Kics2 T C 10: 121,575,912 (GRCm39) V11A probably damaging Het
L3hypdh T C 12: 72,124,016 (GRCm39) I281V probably benign Het
Lins1 T G 7: 66,364,435 (GRCm39) probably benign Het
Map4k5 T A 12: 69,871,372 (GRCm39) I517L possibly damaging Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mlkl C G 8: 112,046,348 (GRCm39) probably null Het
Mllt1 A G 17: 57,209,630 (GRCm39) M160T probably benign Het
Mmp15 G A 8: 96,094,824 (GRCm39) A233T possibly damaging Het
Moxd2 C A 6: 40,868,537 (GRCm39) T23N probably benign Het
Nop53 C A 7: 15,676,812 (GRCm39) K100N probably benign Het
Nrg1 C A 8: 32,408,228 (GRCm39) E2* probably null Het
Or52u1 T A 7: 104,237,696 (GRCm39) H228Q probably benign Het
Pank4 A G 4: 155,059,091 (GRCm39) D408G possibly damaging Het
Pcdhb10 T C 18: 37,544,995 (GRCm39) W24R probably benign Het
Pcm1 C T 8: 41,740,775 (GRCm39) T968I probably damaging Het
Ppy A G 11: 101,991,345 (GRCm39) probably null Het
Pramel21 G A 4: 143,343,801 (GRCm39) R367K probably benign Het
Prdx3 A C 19: 60,861,621 (GRCm39) C39W possibly damaging Het
Qrfpr T G 3: 36,276,073 (GRCm39) N106H probably benign Het
Rai14 G A 15: 10,575,776 (GRCm39) T394M possibly damaging Het
Ralgapa2 A T 2: 146,188,669 (GRCm39) L1371Q probably benign Het
Rbm12 A G 2: 155,939,048 (GRCm39) L408P probably damaging Het
Rdx T C 9: 51,977,174 (GRCm39) I141T probably benign Het
Reep1 T A 6: 71,684,985 (GRCm39) V11E possibly damaging Het
Relch T A 1: 105,649,030 (GRCm39) M723K probably benign Het
Sall4 A G 2: 168,592,347 (GRCm39) S936P probably damaging Het
Serac1 A G 17: 6,102,065 (GRCm39) M403T possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc35g2 T G 9: 100,435,549 (GRCm39) I41L probably benign Het
Slc39a12 G A 2: 14,405,134 (GRCm39) S242N probably benign Het
Slc9a2 T A 1: 40,801,076 (GRCm39) D535E probably damaging Het
Spata31d1a G T 13: 59,849,459 (GRCm39) P890T probably damaging Het
Sync A G 4: 129,187,232 (GRCm39) Q88R probably benign Het
Tdrp A G 8: 14,024,527 (GRCm39) probably benign Het
Tg G T 15: 66,565,168 (GRCm39) C1170F probably damaging Het
Tnks A T 8: 35,318,937 (GRCm39) D781E probably benign Het
Tnp2 T A 16: 10,606,207 (GRCm39) T87S possibly damaging Het
Tpp2 T C 1: 44,010,875 (GRCm39) V554A probably benign Het
Traf3ip2 T C 10: 39,521,735 (GRCm39) I431T probably damaging Het
Trav9d-4 A T 14: 53,221,258 (GRCm39) H84L probably damaging Het
Vmn2r42 T A 7: 8,187,276 (GRCm39) Y782F probably damaging Het
Vwf T C 6: 125,547,567 (GRCm39) S231P probably damaging Het
Wdr83os A G 8: 85,808,496 (GRCm39) S83G probably damaging Het
Wdr91 T A 6: 34,885,234 (GRCm39) Q109L probably damaging Het
Znrf4 A G 17: 56,818,864 (GRCm39) C148R possibly damaging Het
Other mutations in Pkib
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2508:Pkib UTSW 10 57,604,205 (GRCm39) missense probably damaging 1.00
R6416:Pkib UTSW 10 57,604,234 (GRCm39) missense probably damaging 0.99
R7297:Pkib UTSW 10 57,612,422 (GRCm39) missense possibly damaging 0.90
R7526:Pkib UTSW 10 57,612,394 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGGCTTGCATGTGCTCCTG -3'
(R):5'- CTATTCTGGTCACTGTCATGGG -3'

Sequencing Primer
(F):5'- GCAAAATTAGACTTTTGGTGTGC -3'
(R):5'- CTGGTCACTGTCATGGGTTAATTAAG -3'
Posted On 2015-11-11