Mutagenetix > Incidental Mutation

Incidental Mutation 'R4760:Ipo5'

356830

Institutional Source

Beutler Lab

Gene Symbol

Ipo5

Ensembl Gene

ENSMUSG00000030662

Gene Name

importin 5

Synonyms

Ranbp5, Kpnb3, 5730478E03Rik, IMB3, 1110011C18Rik

MMRRC Submission

041974-MU

Accession Numbers

Genbank: NM_023579; MGI: 1917822

Essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R4760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120911224-120947999 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120941642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 779 (V779A)

Ref Sequence

ENSEMBL: ENSMUSP00000032898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032898]

AlphaFold

Q8BKC5

Predicted Effect

probably benign
Transcript: ENSMUST00000032898
AA Change: V779A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: V779A

Domain	Start	End	E-Value	Type
low complexity region	65	72	N/A	INTRINSIC
Pfam:HEAT_2	359	467	3.3e-13	PFAM
Pfam:HEAT_EZ	372	426	3.7e-10	PFAM
Pfam:Vac14_Fab1_bd	373	430	3.8e-9	PFAM
Pfam:HEAT	400	430	4.2e-7	PFAM
Pfam:HEAT	906	936	4.2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228277

Meta Mutation Damage Score

0.0619

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,721,305	M723K	probably benign	Het
A530053G22Rik	A	G	6: 60,402,101		noncoding transcript	Het
Abcc2	A	T	19: 43,810,481	Y512F	probably benign	Het
Adgrb1	T	A	15: 74,571,463	I51N	probably damaging	Het
Adhfe1	A	G	1: 9,563,523	Y332C	probably damaging	Het
Ambn	C	T	5: 88,467,707	L317F	probably damaging	Het
Amn1	T	C	6: 149,185,113	Y17C	probably benign	Het
Apoa5	T	C	9: 46,270,295	V223A	probably damaging	Het
BC048403	T	C	10: 121,740,007	V11A	probably damaging	Het
Best3	A	T	10: 117,024,794	H653L	probably benign	Het
Btnl2	C	A	17: 34,363,195	S245Y	probably damaging	Het
Camk1d	A	G	2: 5,362,056	L116P	probably damaging	Het
Catsperg2	T	A	7: 29,705,635	D698V	probably damaging	Het
Cd33	T	C	7: 43,529,495	T307A	probably benign	Het
Cdk8	C	T	5: 146,292,666	S230L	probably benign	Het
Cfap69	C	T	5: 5,646,939	C119Y	probably damaging	Het
Chat	T	C	14: 32,453,737	N122S	probably benign	Het
Col20a1	A	T	2: 180,984,403		probably benign	Het
Cyp2j9	A	T	4: 96,568,791	L481Q	probably damaging	Het
Dab1	A	C	4: 104,732,145	S550R	probably damaging	Het
Dlgap2	A	C	8: 14,773,380	Q533P	probably damaging	Het
Eif4g3	A	T	4: 138,084,318	Q31L	possibly damaging	Het
Ets2	G	A	16: 95,719,043	V438M	probably damaging	Het
Eva1c	G	A	16: 90,904,250	D258N	probably benign	Het
Fastkd2	A	G	1: 63,745,886	H477R	probably benign	Het
Fga	T	G	3: 83,031,514	S399A	probably benign	Het
Fmo4	T	A	1: 162,809,827	E32V	probably damaging	Het
Gm13083	G	A	4: 143,617,231	R367K	probably benign	Het
Gm1840	G	A	8: 5,640,473		noncoding transcript	Het
Gm7204	T	A	16: 48,218,688		noncoding transcript	Het
Hhipl1	A	G	12: 108,320,077	I548V	probably damaging	Het
Hsfy2	T	C	1: 56,637,190	T63A	probably benign	Het
Igf2r	A	G	17: 12,703,465	V1254A	possibly damaging	Het
Ighv8-4	A	T	12: 115,024,047	D110E	probably damaging	Het
Igkv14-130	T	C	6: 67,791,462	S101P	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Itpr1	C	T	6: 108,349,632	T105I	probably benign	Het
Kalrn	T	C	16: 34,198,487	M670V	probably damaging	Het
Kdm8	T	A	7: 125,455,259		probably null	Het
L3hypdh	T	C	12: 72,077,242	I281V	probably benign	Het
Lins1	T	G	7: 66,714,687		probably benign	Het
Map4k5	T	A	12: 69,824,598	I517L	possibly damaging	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mlkl	C	G	8: 111,319,716		probably null	Het
Mllt1	A	G	17: 56,902,630	M160T	probably benign	Het
Mmp15	G	A	8: 95,368,196	A233T	possibly damaging	Het
Moxd2	C	A	6: 40,891,603	T23N	probably benign	Het
Nop53	C	A	7: 15,942,887	K100N	probably benign	Het
Nrg1	C	A	8: 31,918,200	E2*	probably null	Het
Olfr654	T	A	7: 104,588,489	H228Q	probably benign	Het
Pank4	A	G	4: 154,974,634	D408G	possibly damaging	Het
Pcdhb10	T	C	18: 37,411,942	W24R	probably benign	Het
Pcm1	C	T	8: 41,287,738	T968I	probably damaging	Het
Pkib	G	T	10: 57,708,150	M19I	probably benign	Het
Ppy	A	G	11: 102,100,519		probably null	Het
Prdx3	A	C	19: 60,873,183	C39W	possibly damaging	Het
Qrfpr	T	G	3: 36,221,924	N106H	probably benign	Het
Rai14	G	A	15: 10,575,690	T394M	possibly damaging	Het
Ralgapa2	A	T	2: 146,346,749	L1371Q	probably benign	Het
Rbm12	A	G	2: 156,097,128	L408P	probably damaging	Het
Rdx	T	C	9: 52,065,874	I141T	probably benign	Het
Reep1	T	A	6: 71,708,001	V11E	possibly damaging	Het
Sall4	A	G	2: 168,750,427	S936P	probably damaging	Het
Serac1	A	G	17: 6,051,790	M403T	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc35g2	T	G	9: 100,553,496	I41L	probably benign	Het
Slc39a12	G	A	2: 14,400,323	S242N	probably benign	Het
Slc9a2	T	A	1: 40,761,916	D535E	probably damaging	Het
Spata31d1a	G	T	13: 59,701,645	P890T	probably damaging	Het
Sync	A	G	4: 129,293,439	Q88R	probably benign	Het
Tdrp	A	G	8: 13,974,527		probably benign	Het
Tg	G	T	15: 66,693,319	C1170F	probably damaging	Het
Tnks	A	T	8: 34,851,783	D781E	probably benign	Het
Tnp2	T	A	16: 10,788,343	T87S	possibly damaging	Het
Tpp2	T	C	1: 43,971,715	V554A	probably benign	Het
Traf3ip2	T	C	10: 39,645,739	I431T	probably damaging	Het
Trav9d-4	A	T	14: 52,983,801	H84L	probably damaging	Het
Vmn2r42	T	A	7: 8,184,277	Y782F	probably damaging	Het
Vwf	T	C	6: 125,570,604	S231P	probably damaging	Het
Wdr83os	A	G	8: 85,081,867	S83G	probably damaging	Het
Wdr91	T	A	6: 34,908,299	Q109L	probably damaging	Het
Znrf4	A	G	17: 56,511,864	C148R	possibly damaging	Het

Other mutations in Ipo5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01461:Ipo5	APN	14	120928533	missense	probably damaging	0.98
IGL01614:Ipo5	APN	14	120935095	missense	probably benign	0.01
IGL01835:Ipo5	APN	14	120926238	missense	probably benign	0.24
IGL02010:Ipo5	APN	14	120933377	missense	probably benign	0.20
IGL02303:Ipo5	APN	14	120917383	missense	probably benign
IGL02344:Ipo5	APN	14	120942779	splice site	probably benign
IGL02657:Ipo5	APN	14	120943800	missense	possibly damaging	0.47
IGL03094:Ipo5	APN	14	120943677	splice site	probably benign
IGL03158:Ipo5	APN	14	120941891	splice site	probably benign
IGL03309:Ipo5	APN	14	120920004	missense	probably benign
IGL03392:Ipo5	APN	14	120942687	missense	probably damaging	0.99
3-1:Ipo5	UTSW	14	120932936	missense	probably benign	0.41
PIT4544001:Ipo5	UTSW	14	120928537	missense	probably damaging	0.99
R0326:Ipo5	UTSW	14	120922223	missense	probably benign	0.19
R0505:Ipo5	UTSW	14	120942733	missense	possibly damaging	0.74
R0559:Ipo5	UTSW	14	120938641	missense	probably damaging	1.00
R0590:Ipo5	UTSW	14	120944357	missense	possibly damaging	0.76
R0969:Ipo5	UTSW	14	120944525	missense	possibly damaging	0.64
R1450:Ipo5	UTSW	14	120944393	missense	probably benign	0.04
R1672:Ipo5	UTSW	14	120933302	missense	probably damaging	1.00
R2471:Ipo5	UTSW	14	120922162	missense	probably benign	0.12
R3508:Ipo5	UTSW	14	120939544	missense	probably damaging	1.00
R3696:Ipo5	UTSW	14	120922162	missense	probably benign	0.12
R4118:Ipo5	UTSW	14	120938661	missense	probably benign	0.04
R4418:Ipo5	UTSW	14	120943893	missense	possibly damaging	0.81
R4839:Ipo5	UTSW	14	120920038	missense	probably benign	0.00
R4913:Ipo5	UTSW	14	120935086	missense	probably damaging	1.00
R5326:Ipo5	UTSW	14	120926271	missense	probably benign
R5339:Ipo5	UTSW	14	120943710	missense	probably damaging	1.00
R5483:Ipo5	UTSW	14	120920038	missense	probably benign	0.06
R5542:Ipo5	UTSW	14	120926271	missense	probably benign
R5579:Ipo5	UTSW	14	120938613	missense	probably benign	0.26
R5954:Ipo5	UTSW	14	120919984	missense	probably damaging	1.00
R6948:Ipo5	UTSW	14	120923115	missense	probably benign	0.00
R7365:Ipo5	UTSW	14	120920085	missense	probably benign
R7563:Ipo5	UTSW	14	120946155	missense	probably benign	0.00
R7782:Ipo5	UTSW	14	120933125	missense	possibly damaging	0.95
R7911:Ipo5	UTSW	14	120929639	splice site	probably null
R8222:Ipo5	UTSW	14	120920002	missense	probably benign	0.00
R8238:Ipo5	UTSW	14	120935240	missense	probably damaging	1.00
R8483:Ipo5	UTSW	14	120946148	missense	probably benign
R8826:Ipo5	UTSW	14	120919954	missense	probably damaging	1.00
R9042:Ipo5	UTSW	14	120923135	missense	probably benign	0.01
W0251:Ipo5	UTSW	14	120938785	missense	probably benign	0.17
X0062:Ipo5	UTSW	14	120941671	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CGGTAGAAGTTGGTTACTGTCC -3'
(R):5'- TCAACCTGCTCGTCATAGTC -3'

Sequencing Primer
(F):5'- CTGGCTTTGAATCTGCAACTTGAC -3'
(R):5'- AACCTGCTCGTCATAGTCTTCATC -3'

Posted On

2015-11-11