Mutagenetix > Incidental Mutation

Incidental Mutation 'R4760:Adgrb1'

356833

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

Bai1, B830018M07Rik

MMRRC Submission

041974-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74516195-74589465 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74571463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 51 (I51N)

Ref Sequence

ENSEMBL: ENSMUSP00000140407 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000170845] [ENSMUST00000185682] [ENSMUST00000186360] [ENSMUST00000187485] [ENSMUST00000187599] [ENSMUST00000189353] [ENSMUST00000190524]

AlphaFold

Q3UHD1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042035
AA Change: I991N

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: I991N

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170845
AA Change: I51N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127122
Gene: ENSMUSG00000034730
AA Change: I51N

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	240	1.9e-67	PFAM
SCOP:d1jvr__	456	492	1e-3	SMART
low complexity region	501	515	N/A	INTRINSIC
low complexity region	605	616	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000185682
AA Change: I51N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139428
Gene: ENSMUSG00000034730
AA Change: I51N

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	240	1.9e-67	PFAM
SCOP:d1jvr__	456	492	1e-3	SMART
low complexity region	501	515	N/A	INTRINSIC
low complexity region	605	616	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186095

Predicted Effect

probably damaging
Transcript: ENSMUST00000186360
AA Change: I991N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: I991N

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187485

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000187599
AA Change: I51N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140831
Gene: ENSMUSG00000034730
AA Change: I51N

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	135	6.4e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187639

Predicted Effect

probably damaging
Transcript: ENSMUST00000189353
AA Change: I51N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140889
Gene: ENSMUSG00000034730
AA Change: I51N

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	147	3.5e-39	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000190524
AA Change: I51N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140407
Gene: ENSMUSG00000034730
AA Change: I51N

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	112	4.3e-27	PFAM

Meta Mutation Damage Score

0.5367

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,721,305	M723K	probably benign	Het
A530053G22Rik	A	G	6: 60,402,101		noncoding transcript	Het
Abcc2	A	T	19: 43,810,481	Y512F	probably benign	Het
Adhfe1	A	G	1: 9,563,523	Y332C	probably damaging	Het
Ambn	C	T	5: 88,467,707	L317F	probably damaging	Het
Amn1	T	C	6: 149,185,113	Y17C	probably benign	Het
Apoa5	T	C	9: 46,270,295	V223A	probably damaging	Het
BC048403	T	C	10: 121,740,007	V11A	probably damaging	Het
Best3	A	T	10: 117,024,794	H653L	probably benign	Het
Btnl2	C	A	17: 34,363,195	S245Y	probably damaging	Het
Camk1d	A	G	2: 5,362,056	L116P	probably damaging	Het
Catsperg2	T	A	7: 29,705,635	D698V	probably damaging	Het
Cd33	T	C	7: 43,529,495	T307A	probably benign	Het
Cdk8	C	T	5: 146,292,666	S230L	probably benign	Het
Cfap69	C	T	5: 5,646,939	C119Y	probably damaging	Het
Chat	T	C	14: 32,453,737	N122S	probably benign	Het
Col20a1	A	T	2: 180,984,403		probably benign	Het
Cyp2j9	A	T	4: 96,568,791	L481Q	probably damaging	Het
Dab1	A	C	4: 104,732,145	S550R	probably damaging	Het
Dlgap2	A	C	8: 14,773,380	Q533P	probably damaging	Het
Eif4g3	A	T	4: 138,084,318	Q31L	possibly damaging	Het
Ets2	G	A	16: 95,719,043	V438M	probably damaging	Het
Eva1c	G	A	16: 90,904,250	D258N	probably benign	Het
Fastkd2	A	G	1: 63,745,886	H477R	probably benign	Het
Fga	T	G	3: 83,031,514	S399A	probably benign	Het
Fmo4	T	A	1: 162,809,827	E32V	probably damaging	Het
Gm13083	G	A	4: 143,617,231	R367K	probably benign	Het
Gm1840	G	A	8: 5,640,473		noncoding transcript	Het
Gm7204	T	A	16: 48,218,688		noncoding transcript	Het
Hhipl1	A	G	12: 108,320,077	I548V	probably damaging	Het
Hsfy2	T	C	1: 56,637,190	T63A	probably benign	Het
Igf2r	A	G	17: 12,703,465	V1254A	possibly damaging	Het
Ighv8-4	A	T	12: 115,024,047	D110E	probably damaging	Het
Igkv14-130	T	C	6: 67,791,462	S101P	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Ipo5	T	C	14: 120,941,642	V779A	probably benign	Het
Itpr1	C	T	6: 108,349,632	T105I	probably benign	Het
Kalrn	T	C	16: 34,198,487	M670V	probably damaging	Het
Kdm8	T	A	7: 125,455,259		probably null	Het
L3hypdh	T	C	12: 72,077,242	I281V	probably benign	Het
Lins1	T	G	7: 66,714,687		probably benign	Het
Map4k5	T	A	12: 69,824,598	I517L	possibly damaging	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mlkl	C	G	8: 111,319,716		probably null	Het
Mllt1	A	G	17: 56,902,630	M160T	probably benign	Het
Mmp15	G	A	8: 95,368,196	A233T	possibly damaging	Het
Moxd2	C	A	6: 40,891,603	T23N	probably benign	Het
Nop53	C	A	7: 15,942,887	K100N	probably benign	Het
Nrg1	C	A	8: 31,918,200	E2*	probably null	Het
Olfr654	T	A	7: 104,588,489	H228Q	probably benign	Het
Pank4	A	G	4: 154,974,634	D408G	possibly damaging	Het
Pcdhb10	T	C	18: 37,411,942	W24R	probably benign	Het
Pcm1	C	T	8: 41,287,738	T968I	probably damaging	Het
Pkib	G	T	10: 57,708,150	M19I	probably benign	Het
Ppy	A	G	11: 102,100,519		probably null	Het
Prdx3	A	C	19: 60,873,183	C39W	possibly damaging	Het
Qrfpr	T	G	3: 36,221,924	N106H	probably benign	Het
Rai14	G	A	15: 10,575,690	T394M	possibly damaging	Het
Ralgapa2	A	T	2: 146,346,749	L1371Q	probably benign	Het
Rbm12	A	G	2: 156,097,128	L408P	probably damaging	Het
Rdx	T	C	9: 52,065,874	I141T	probably benign	Het
Reep1	T	A	6: 71,708,001	V11E	possibly damaging	Het
Sall4	A	G	2: 168,750,427	S936P	probably damaging	Het
Serac1	A	G	17: 6,051,790	M403T	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc35g2	T	G	9: 100,553,496	I41L	probably benign	Het
Slc39a12	G	A	2: 14,400,323	S242N	probably benign	Het
Slc9a2	T	A	1: 40,761,916	D535E	probably damaging	Het
Spata31d1a	G	T	13: 59,701,645	P890T	probably damaging	Het
Sync	A	G	4: 129,293,439	Q88R	probably benign	Het
Tdrp	A	G	8: 13,974,527		probably benign	Het
Tg	G	T	15: 66,693,319	C1170F	probably damaging	Het
Tnks	A	T	8: 34,851,783	D781E	probably benign	Het
Tnp2	T	A	16: 10,788,343	T87S	possibly damaging	Het
Tpp2	T	C	1: 43,971,715	V554A	probably benign	Het
Traf3ip2	T	C	10: 39,645,739	I431T	probably damaging	Het
Trav9d-4	A	T	14: 52,983,801	H84L	probably damaging	Het
Vmn2r42	T	A	7: 8,184,277	Y782F	probably damaging	Het
Vwf	T	C	6: 125,570,604	S231P	probably damaging	Het
Wdr83os	A	G	8: 85,081,867	S83G	probably damaging	Het
Wdr91	T	A	6: 34,908,299	Q109L	probably damaging	Het
Znrf4	A	G	17: 56,511,864	C148R	possibly damaging	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74586835	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74548357	splice site	probably benign
IGL01874:Adgrb1	APN	15	74541574	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74541575	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74529782	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74540477	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74574112	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74586805	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74588294	splice site	probably benign
IGL02678:Adgrb1	APN	15	74538328	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74547622	missense	probably damaging	0.98
Bunting	UTSW	15	74543701	missense	probably null	0.94
BB005:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
BB015:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
PIT4520001:Adgrb1	UTSW	15	74541659	missense	probably damaging	0.99
R0193:Adgrb1	UTSW	15	74572156	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74586807	missense	probably benign
R0267:Adgrb1	UTSW	15	74529389	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74587149	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74543349	missense	probably damaging	0.97
R0533:Adgrb1	UTSW	15	74541559	missense	probably damaging	1.00
R0635:Adgrb1	UTSW	15	74540892	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74548549	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1122:Adgrb1	UTSW	15	74547685	missense	probably damaging	0.99
R1295:Adgrb1	UTSW	15	74550039	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74588107	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74529343	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74541827	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74529540	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74580586	nonsense	probably null
R1895:Adgrb1	UTSW	15	74540465	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74539877	splice site	probably benign
R2114:Adgrb1	UTSW	15	74540562	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74529908	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74547704	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74545015	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74588308	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74582943	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74543662	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74577453	unclassified	probably benign
R4634:Adgrb1	UTSW	15	74584429	utr 3 prime	probably benign
R4683:Adgrb1	UTSW	15	74588114	missense	probably damaging	1.00
R4742:Adgrb1	UTSW	15	74529479	nonsense	probably null
R4794:Adgrb1	UTSW	15	74588129	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74587022	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74572162	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74529815	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74543701	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74577499	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74550027	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74541574	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74538370	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74540459	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74588143	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74529361	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74550024	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74529901	missense	probably damaging	0.97
R7015:Adgrb1	UTSW	15	74574110	missense	probably damaging	1.00
R7061:Adgrb1	UTSW	15	74569881	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74569948	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74569884	missense	probably benign
R7283:Adgrb1	UTSW	15	74580663	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74548569	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74543638	missense	possibly damaging	0.95
R7928:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
R8152:Adgrb1	UTSW	15	74541611	missense	probably benign	0.00
R8152:Adgrb1	UTSW	15	74545000	missense	probably damaging	0.98
R8198:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R8485:Adgrb1	UTSW	15	74548304	missense	probably damaging	1.00
R8528:Adgrb1	UTSW	15	74575851	missense	possibly damaging	0.51
R8534:Adgrb1	UTSW	15	74543508	missense	probably damaging	0.97
R8865:Adgrb1	UTSW	15	74543658	missense	possibly damaging	0.75
R9044:Adgrb1	UTSW	15	74569899	missense	possibly damaging	0.95
R9098:Adgrb1	UTSW	15	74543340	missense	probably damaging	1.00
R9157:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
R9166:Adgrb1	UTSW	15	74548626	missense	probably benign	0.00
R9313:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
R9445:Adgrb1	UTSW	15	74563958	critical splice acceptor site	probably benign
Z1177:Adgrb1	UTSW	15	74541676	missense	probably damaging	1.00
Z1177:Adgrb1	UTSW	15	74547683	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GATTCGTAATGACAGTAGTGATGG -3'
(R):5'- GCCCCTGGGTCATATTTGTC -3'

Sequencing Primer
(F):5'- TAATGACAGTAGTGATGGTGGTGAC -3'
(R):5'- CCCTGGGTCATATTTGTCAAGACAG -3'

Posted On

2015-11-11