Incidental Mutation 'R4760:Eva1c'
ID 356839
Institutional Source Beutler Lab
Gene Symbol Eva1c
Ensembl Gene ENSMUSG00000039903
Gene Name eva-1 homolog C
Synonyms 4931408A02Rik, 1700092M14Rik, Fam176c
MMRRC Submission 041974-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4760 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 90623607-90701997 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 90701138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 258 (D258N)
Ref Sequence ENSEMBL: ENSMUSP00000156225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037539] [ENSMUST00000099543] [ENSMUST00000099548] [ENSMUST00000130868] [ENSMUST00000152223] [ENSMUST00000231280] [ENSMUST00000231964]
AlphaFold P58659
Predicted Effect probably benign
Transcript: ENSMUST00000037539
AA Change: D365N

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903
AA Change: D365N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099543
AA Change: D317N

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903
AA Change: D317N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099548
AA Change: D371N

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903
AA Change: D371N

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231280
AA Change: D258N

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000231964
AA Change: D270N

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232665
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit an abnormal pupilary reflex in response to dilating drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530053G22Rik A G 6: 60,379,086 (GRCm39) noncoding transcript Het
Abcc2 A T 19: 43,798,920 (GRCm39) Y512F probably benign Het
Adgrb1 T A 15: 74,443,312 (GRCm39) I51N probably damaging Het
Adhfe1 A G 1: 9,633,748 (GRCm39) Y332C probably damaging Het
Ambn C T 5: 88,615,566 (GRCm39) L317F probably damaging Het
Amn1 T C 6: 149,086,611 (GRCm39) Y17C probably benign Het
Apoa5 T C 9: 46,181,593 (GRCm39) V223A probably damaging Het
Best3 A T 10: 116,860,699 (GRCm39) H653L probably benign Het
Btnl2 C A 17: 34,582,169 (GRCm39) S245Y probably damaging Het
Camk1d A G 2: 5,366,867 (GRCm39) L116P probably damaging Het
Catsperg2 T A 7: 29,405,060 (GRCm39) D698V probably damaging Het
Cd33 T C 7: 43,178,919 (GRCm39) T307A probably benign Het
Cdk8 C T 5: 146,229,476 (GRCm39) S230L probably benign Het
Cfap69 C T 5: 5,696,939 (GRCm39) C119Y probably damaging Het
Chat T C 14: 32,175,694 (GRCm39) N122S probably benign Het
Col20a1 A T 2: 180,626,196 (GRCm39) probably benign Het
Cyp2j9 A T 4: 96,457,028 (GRCm39) L481Q probably damaging Het
Dab1 A C 4: 104,589,342 (GRCm39) S550R probably damaging Het
Dlgap2 A C 8: 14,823,380 (GRCm39) Q533P probably damaging Het
Eif4g3 A T 4: 137,811,629 (GRCm39) Q31L possibly damaging Het
Ets2 G A 16: 95,520,087 (GRCm39) V438M probably damaging Het
Fastkd2 A G 1: 63,785,045 (GRCm39) H477R probably benign Het
Fga T G 3: 82,938,821 (GRCm39) S399A probably benign Het
Fmo4 T A 1: 162,637,396 (GRCm39) E32V probably damaging Het
Gm7204 T A 16: 48,039,051 (GRCm39) noncoding transcript Het
Gpi-ps G A 8: 5,690,473 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,286,336 (GRCm39) I548V probably damaging Het
Hsfy2 T C 1: 56,676,349 (GRCm39) T63A probably benign Het
Igf2r A G 17: 12,922,352 (GRCm39) V1254A possibly damaging Het
Ighv8-4 A T 12: 114,987,667 (GRCm39) D110E probably damaging Het
Igkv14-130 T C 6: 67,768,446 (GRCm39) S101P probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ipo5 T C 14: 121,179,054 (GRCm39) V779A probably benign Het
Itpr1 C T 6: 108,326,593 (GRCm39) T105I probably benign Het
Kalrn T C 16: 34,018,857 (GRCm39) M670V probably damaging Het
Kdm8 T A 7: 125,054,431 (GRCm39) probably null Het
Kics2 T C 10: 121,575,912 (GRCm39) V11A probably damaging Het
L3hypdh T C 12: 72,124,016 (GRCm39) I281V probably benign Het
Lins1 T G 7: 66,364,435 (GRCm39) probably benign Het
Map4k5 T A 12: 69,871,372 (GRCm39) I517L possibly damaging Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mlkl C G 8: 112,046,348 (GRCm39) probably null Het
Mllt1 A G 17: 57,209,630 (GRCm39) M160T probably benign Het
Mmp15 G A 8: 96,094,824 (GRCm39) A233T possibly damaging Het
Moxd2 C A 6: 40,868,537 (GRCm39) T23N probably benign Het
Nop53 C A 7: 15,676,812 (GRCm39) K100N probably benign Het
Nrg1 C A 8: 32,408,228 (GRCm39) E2* probably null Het
Or52u1 T A 7: 104,237,696 (GRCm39) H228Q probably benign Het
Pank4 A G 4: 155,059,091 (GRCm39) D408G possibly damaging Het
Pcdhb10 T C 18: 37,544,995 (GRCm39) W24R probably benign Het
Pcm1 C T 8: 41,740,775 (GRCm39) T968I probably damaging Het
Pkib G T 10: 57,584,246 (GRCm39) M19I probably benign Het
Ppy A G 11: 101,991,345 (GRCm39) probably null Het
Pramel21 G A 4: 143,343,801 (GRCm39) R367K probably benign Het
Prdx3 A C 19: 60,861,621 (GRCm39) C39W possibly damaging Het
Qrfpr T G 3: 36,276,073 (GRCm39) N106H probably benign Het
Rai14 G A 15: 10,575,776 (GRCm39) T394M possibly damaging Het
Ralgapa2 A T 2: 146,188,669 (GRCm39) L1371Q probably benign Het
Rbm12 A G 2: 155,939,048 (GRCm39) L408P probably damaging Het
Rdx T C 9: 51,977,174 (GRCm39) I141T probably benign Het
Reep1 T A 6: 71,684,985 (GRCm39) V11E possibly damaging Het
Relch T A 1: 105,649,030 (GRCm39) M723K probably benign Het
Sall4 A G 2: 168,592,347 (GRCm39) S936P probably damaging Het
Serac1 A G 17: 6,102,065 (GRCm39) M403T possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc35g2 T G 9: 100,435,549 (GRCm39) I41L probably benign Het
Slc39a12 G A 2: 14,405,134 (GRCm39) S242N probably benign Het
Slc9a2 T A 1: 40,801,076 (GRCm39) D535E probably damaging Het
Spata31d1a G T 13: 59,849,459 (GRCm39) P890T probably damaging Het
Sync A G 4: 129,187,232 (GRCm39) Q88R probably benign Het
Tdrp A G 8: 14,024,527 (GRCm39) probably benign Het
Tg G T 15: 66,565,168 (GRCm39) C1170F probably damaging Het
Tnks A T 8: 35,318,937 (GRCm39) D781E probably benign Het
Tnp2 T A 16: 10,606,207 (GRCm39) T87S possibly damaging Het
Tpp2 T C 1: 44,010,875 (GRCm39) V554A probably benign Het
Traf3ip2 T C 10: 39,521,735 (GRCm39) I431T probably damaging Het
Trav9d-4 A T 14: 53,221,258 (GRCm39) H84L probably damaging Het
Vmn2r42 T A 7: 8,187,276 (GRCm39) Y782F probably damaging Het
Vwf T C 6: 125,547,567 (GRCm39) S231P probably damaging Het
Wdr83os A G 8: 85,808,496 (GRCm39) S83G probably damaging Het
Wdr91 T A 6: 34,885,234 (GRCm39) Q109L probably damaging Het
Znrf4 A G 17: 56,818,864 (GRCm39) C148R possibly damaging Het
Other mutations in Eva1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Eva1c APN 16 90,701,235 (GRCm39) missense probably damaging 1.00
IGL02061:Eva1c APN 16 90,663,163 (GRCm39) nonsense probably null
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0455:Eva1c UTSW 16 90,672,986 (GRCm39) missense probably benign 0.03
R1330:Eva1c UTSW 16 90,701,284 (GRCm39) missense probably damaging 1.00
R1765:Eva1c UTSW 16 90,701,135 (GRCm39) missense probably benign 0.01
R1824:Eva1c UTSW 16 90,663,331 (GRCm39) missense probably benign 0.01
R1880:Eva1c UTSW 16 90,694,303 (GRCm39) missense possibly damaging 0.75
R2248:Eva1c UTSW 16 90,628,213 (GRCm39) missense probably benign 0.12
R4072:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4076:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4622:Eva1c UTSW 16 90,694,343 (GRCm39) critical splice donor site probably null
R4767:Eva1c UTSW 16 90,701,235 (GRCm39) missense probably damaging 1.00
R5024:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R5304:Eva1c UTSW 16 90,666,551 (GRCm39) missense probably damaging 1.00
R5559:Eva1c UTSW 16 90,701,139 (GRCm39) missense probably benign 0.06
R6605:Eva1c UTSW 16 90,663,236 (GRCm39) missense probably damaging 1.00
R7222:Eva1c UTSW 16 90,701,072 (GRCm39) small deletion probably benign
R7409:Eva1c UTSW 16 90,666,544 (GRCm39) missense probably damaging 1.00
R7449:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R8489:Eva1c UTSW 16 90,672,999 (GRCm39) missense probably damaging 1.00
R8687:Eva1c UTSW 16 90,687,433 (GRCm39) missense probably benign 0.42
R9091:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
R9270:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCTGGTCCACTGTGATGAAAAC -3'
(R):5'- TGAATGACTTGCTCCCTGCG -3'

Sequencing Primer
(F):5'- AGATTTTACCACATGAGCCTGTCG -3'
(R):5'- GCGTTCAATCCTTTCCGCCAG -3'
Posted On 2015-11-11