Incidental Mutation 'R0403:Jchain'
ID 35684
Institutional Source Beutler Lab
Gene Symbol Jchain
Ensembl Gene ENSMUSG00000067149
Gene Name immunoglobulin joining chain
Synonyms J chain, Jch, 9530090F24Rik, Igj
MMRRC Submission 038608-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0403 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 88667663-88675667 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88669237 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 139 (R139G)
Ref Sequence ENSEMBL: ENSMUSP00000084259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087033]
AlphaFold P01592
Predicted Effect probably benign
Transcript: ENSMUST00000087033
AA Change: R139G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000084259
Gene: ENSMUSG00000067149
AA Change: R139G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_J_chain 23 159 6.3e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164073
SMART Domains Protein: ENSMUSP00000132955
Gene: ENSMUSG00000067149

DomainStartEndE-ValueType
Pfam:Ig_J_chain 1 119 1.3e-72 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show increased IgA level and alterations in IgA transport and in susceptibility to viral and parasitic infections. Homozygotes for another null allele show increased IgA level, decreased IgM level, reduced numbers of IgM plasma cells, and impaired IgM immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,864,706 (GRCm39) probably null Het
Adgrg3 C T 8: 95,763,550 (GRCm39) L284F probably benign Het
Alkbh8 T A 9: 3,385,469 (GRCm39) V587E probably damaging Het
Ap4b1 T A 3: 103,728,712 (GRCm39) M590K probably benign Het
Ap4b1 T A 3: 103,726,155 (GRCm39) C244S probably damaging Het
Arhgap15 C T 2: 43,953,778 (GRCm39) T168I probably damaging Het
Atp8b1 A G 18: 64,673,381 (GRCm39) V997A probably damaging Het
Atrn G A 2: 130,748,779 (GRCm39) C100Y probably damaging Het
Baiap2l2 C A 15: 79,155,416 (GRCm39) A151S probably benign Het
Baz2b A T 2: 59,799,721 (GRCm39) D199E possibly damaging Het
Bmal2 T A 6: 146,724,153 (GRCm39) H348Q probably damaging Het
Cblb A G 16: 51,972,989 (GRCm39) D440G probably benign Het
Cdon T C 9: 35,384,796 (GRCm39) V694A probably benign Het
Cep250 A T 2: 155,834,269 (GRCm39) R2065W probably damaging Het
Ces2b G T 8: 105,560,577 (GRCm39) A131S probably damaging Het
Chrna9 A T 5: 66,125,235 (GRCm39) T59S possibly damaging Het
Cog3 T A 14: 75,979,767 (GRCm39) probably benign Het
Cpa1 G A 6: 30,641,856 (GRCm39) V227I probably benign Het
Cyp3a25 A T 5: 145,935,323 (GRCm39) C98S probably damaging Het
D8Ertd738e C T 8: 84,976,230 (GRCm39) probably null Het
Ddx60 A G 8: 62,447,575 (GRCm39) probably benign Het
Dhx16 T C 17: 36,193,942 (GRCm39) probably null Het
Dnah9 T A 11: 65,975,615 (GRCm39) Q1478L possibly damaging Het
Dock10 T C 1: 80,501,787 (GRCm39) Y1434C possibly damaging Het
Enpp3 T A 10: 24,680,334 (GRCm39) D325V probably damaging Het
Entpd6 C A 2: 150,602,090 (GRCm39) T194K possibly damaging Het
Fat2 A T 11: 55,161,175 (GRCm39) V3185E probably benign Het
Flrt1 A G 19: 7,073,284 (GRCm39) L421P probably benign Het
Fmn2 A T 1: 174,521,844 (GRCm39) Q1292L probably damaging Het
Fndc1 T C 17: 7,972,555 (GRCm39) D1459G probably damaging Het
Fndc1 T C 17: 7,994,420 (GRCm39) probably null Het
Fzr1 A G 10: 81,205,202 (GRCm39) S265P possibly damaging Het
Gpr142 G A 11: 114,696,855 (GRCm39) V134M probably damaging Het
Grid2ip G T 5: 143,343,375 (GRCm39) V24L possibly damaging Het
Herc2 G A 7: 55,809,165 (GRCm39) R2555H probably damaging Het
Hpdl A T 4: 116,677,676 (GRCm39) Y262N possibly damaging Het
Htr3a A G 9: 48,819,959 (GRCm39) V57A probably damaging Het
Igfbp7 T C 5: 77,503,438 (GRCm39) I186V probably benign Het
Itga2b C T 11: 102,358,152 (GRCm39) probably null Het
Itgae A C 11: 73,014,009 (GRCm39) D736A possibly damaging Het
Itpkc T A 7: 26,907,770 (GRCm39) M645L probably benign Het
Kif13a A G 13: 46,944,877 (GRCm39) V908A probably damaging Het
Kif1b T A 4: 149,266,424 (GRCm39) K389* probably null Het
Klhl12 T C 1: 134,413,594 (GRCm39) Y360H possibly damaging Het
Knop1 G A 7: 118,452,276 (GRCm39) R148W probably damaging Het
Lpar1 T A 4: 58,487,191 (GRCm39) N27Y probably damaging Het
Lpar2 T A 8: 70,276,802 (GRCm39) V197D probably damaging Het
Lrrc74a A G 12: 86,787,753 (GRCm39) N128S probably damaging Het
Lum G T 10: 97,407,905 (GRCm39) V337F probably benign Het
Mag T C 7: 30,606,405 (GRCm39) D344G probably damaging Het
Maip1 G A 1: 57,446,355 (GRCm39) A142T probably benign Het
Mlh3 A G 12: 85,315,742 (GRCm39) V148A possibly damaging Het
Nav3 A G 10: 109,602,964 (GRCm39) V1195A probably damaging Het
Ncor2 A G 5: 125,110,401 (GRCm39) S868P possibly damaging Het
Nek1 A G 8: 61,559,889 (GRCm39) E907G probably damaging Het
Nfam1 G A 15: 82,900,580 (GRCm39) T134I probably benign Het
Nr0b2 T C 4: 133,281,070 (GRCm39) V112A probably damaging Het
Nrp1 A G 8: 129,184,450 (GRCm39) N365S probably damaging Het
Nrsn2 T C 2: 152,211,710 (GRCm39) Y107C probably damaging Het
Ntng1 G A 3: 109,841,927 (GRCm39) A282V probably damaging Het
Nxf1 T C 19: 8,742,392 (GRCm39) I337T probably damaging Het
Obscn C T 11: 58,967,366 (GRCm39) G479D probably damaging Het
Oprd1 T A 4: 131,841,079 (GRCm39) D293V probably benign Het
Or13a17 T C 7: 140,271,222 (GRCm39) S135P possibly damaging Het
P3h2 T G 16: 25,788,700 (GRCm39) N586H possibly damaging Het
Pcid2 T C 8: 13,135,367 (GRCm39) Y214C probably damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Pkd1l3 G A 8: 110,350,295 (GRCm39) S380N probably benign Het
Ppic C A 18: 53,544,143 (GRCm39) G81W probably damaging Het
Ppp2r1a C A 17: 21,177,303 (GRCm39) P246T probably damaging Het
Ppp4r4 T G 12: 103,550,361 (GRCm39) S46A probably benign Het
Pramel31 A G 4: 144,089,216 (GRCm39) N178S probably benign Het
Prkce A G 17: 86,476,081 (GRCm39) T21A probably damaging Het
Prkg2 T C 5: 99,142,504 (GRCm39) E210G possibly damaging Het
Prss35 A G 9: 86,638,090 (GRCm39) M287V probably damaging Het
Psd G A 19: 46,309,411 (GRCm39) probably benign Het
Ptch2 A T 4: 116,968,036 (GRCm39) K843* probably null Het
Rab44 C A 17: 29,364,235 (GRCm39) T603K probably damaging Het
Rasal3 T A 17: 32,611,764 (GRCm39) probably null Het
Rbbp6 A G 7: 122,591,519 (GRCm39) T526A probably damaging Het
Ros1 A T 10: 52,019,534 (GRCm39) probably benign Het
Sec24b T A 3: 129,783,325 (GRCm39) L1104F possibly damaging Het
Sec24b A G 3: 129,793,183 (GRCm39) S685P probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Setmar A T 6: 108,052,923 (GRCm39) H139L probably benign Het
Slc28a2b T C 2: 122,352,335 (GRCm39) L364S probably damaging Het
Slc4a7 T C 14: 14,766,808 (GRCm38) V710A probably benign Het
Smarcc1 T A 9: 110,066,876 (GRCm39) probably null Het
Smchd1 G A 17: 71,701,897 (GRCm39) L1032F probably damaging Het
Speg T C 1: 75,407,428 (GRCm39) probably benign Het
Tasor2 A T 13: 3,632,052 (GRCm39) Y816* probably null Het
Tcea1 C G 1: 4,959,726 (GRCm39) R134G probably benign Het
Tchhl1 C T 3: 93,378,336 (GRCm39) Q347* probably null Het
Tecrl A T 5: 83,502,605 (GRCm39) probably benign Het
Tepsin T C 11: 119,984,508 (GRCm39) probably benign Het
Tmem40 G A 6: 115,710,946 (GRCm39) probably benign Het
Tpr G A 1: 150,283,165 (GRCm39) probably benign Het
Ttll12 A T 15: 83,464,859 (GRCm39) probably benign Het
Ttn T A 2: 76,739,952 (GRCm39) D3529V probably benign Het
Usp34 T A 11: 23,283,838 (GRCm39) H177Q possibly damaging Het
Vsig10 T A 5: 117,476,526 (GRCm39) S327T probably benign Het
Zbtb4 T A 11: 69,668,465 (GRCm39) M396K probably damaging Het
Zfp352 C T 4: 90,113,246 (GRCm39) T462I possibly damaging Het
Zfp385b T C 2: 77,307,189 (GRCm39) M145V probably damaging Het
Zfp780b C A 7: 27,671,114 (GRCm39) V65F possibly damaging Het
Other mutations in Jchain
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Jchain APN 5 88,669,383 (GRCm39) missense probably damaging 1.00
R0718:Jchain UTSW 5 88,674,061 (GRCm39) missense probably benign 0.00
R1470:Jchain UTSW 5 88,673,979 (GRCm39) missense probably benign 0.21
R1470:Jchain UTSW 5 88,673,979 (GRCm39) missense probably benign 0.21
R1987:Jchain UTSW 5 88,669,326 (GRCm39) missense probably damaging 0.99
R3684:Jchain UTSW 5 88,670,398 (GRCm39) missense probably damaging 1.00
R5010:Jchain UTSW 5 88,670,364 (GRCm39) missense probably damaging 0.98
R5785:Jchain UTSW 5 88,670,376 (GRCm39) missense probably benign 0.13
R6076:Jchain UTSW 5 88,675,631 (GRCm39) missense probably benign
R6250:Jchain UTSW 5 88,674,034 (GRCm39) missense probably benign 0.00
R6275:Jchain UTSW 5 88,669,212 (GRCm39) missense probably damaging 1.00
R9066:Jchain UTSW 5 88,675,638 (GRCm39) start codon destroyed probably benign 0.22
R9576:Jchain UTSW 5 88,673,976 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGATGTGCGAAAGCTCCAG -3'
(R):5'- TGCAAGAGCAAGCAGACTTCAGAC -3'

Sequencing Primer
(F):5'- ATCTCCTTGAGCAGACATGAG -3'
(R):5'- ATATTGAGATAACATTTGCTGAGGG -3'
Posted On 2013-05-09