Mutagenetix > Incidental Mutation

Incidental Mutation 'R4760:Igf2r'

356842

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

041974-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R4760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12703465 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1254 (V1254A)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024599
AA Change: V1254A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: V1254A

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161738

SMART Domains

Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
Pfam:CIMR	1	65	3.1e-24	PFAM
Pfam:CIMR	68	129	6.1e-15	PFAM

Meta Mutation Damage Score

0.7291

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,721,305	M723K	probably benign	Het
A530053G22Rik	A	G	6: 60,402,101		noncoding transcript	Het
Abcc2	A	T	19: 43,810,481	Y512F	probably benign	Het
Adgrb1	T	A	15: 74,571,463	I51N	probably damaging	Het
Adhfe1	A	G	1: 9,563,523	Y332C	probably damaging	Het
Ambn	C	T	5: 88,467,707	L317F	probably damaging	Het
Amn1	T	C	6: 149,185,113	Y17C	probably benign	Het
Apoa5	T	C	9: 46,270,295	V223A	probably damaging	Het
BC048403	T	C	10: 121,740,007	V11A	probably damaging	Het
Best3	A	T	10: 117,024,794	H653L	probably benign	Het
Btnl2	C	A	17: 34,363,195	S245Y	probably damaging	Het
Camk1d	A	G	2: 5,362,056	L116P	probably damaging	Het
Catsperg2	T	A	7: 29,705,635	D698V	probably damaging	Het
Cd33	T	C	7: 43,529,495	T307A	probably benign	Het
Cdk8	C	T	5: 146,292,666	S230L	probably benign	Het
Cfap69	C	T	5: 5,646,939	C119Y	probably damaging	Het
Chat	T	C	14: 32,453,737	N122S	probably benign	Het
Col20a1	A	T	2: 180,984,403		probably benign	Het
Cyp2j9	A	T	4: 96,568,791	L481Q	probably damaging	Het
Dab1	A	C	4: 104,732,145	S550R	probably damaging	Het
Dlgap2	A	C	8: 14,773,380	Q533P	probably damaging	Het
Eif4g3	A	T	4: 138,084,318	Q31L	possibly damaging	Het
Ets2	G	A	16: 95,719,043	V438M	probably damaging	Het
Eva1c	G	A	16: 90,904,250	D258N	probably benign	Het
Fastkd2	A	G	1: 63,745,886	H477R	probably benign	Het
Fga	T	G	3: 83,031,514	S399A	probably benign	Het
Fmo4	T	A	1: 162,809,827	E32V	probably damaging	Het
Gm13083	G	A	4: 143,617,231	R367K	probably benign	Het
Gm1840	G	A	8: 5,640,473		noncoding transcript	Het
Gm7204	T	A	16: 48,218,688		noncoding transcript	Het
Hhipl1	A	G	12: 108,320,077	I548V	probably damaging	Het
Hsfy2	T	C	1: 56,637,190	T63A	probably benign	Het
Ighv8-4	A	T	12: 115,024,047	D110E	probably damaging	Het
Igkv14-130	T	C	6: 67,791,462	S101P	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Ipo5	T	C	14: 120,941,642	V779A	probably benign	Het
Itpr1	C	T	6: 108,349,632	T105I	probably benign	Het
Kalrn	T	C	16: 34,198,487	M670V	probably damaging	Het
Kdm8	T	A	7: 125,455,259		probably null	Het
L3hypdh	T	C	12: 72,077,242	I281V	probably benign	Het
Lins1	T	G	7: 66,714,687		probably benign	Het
Map4k5	T	A	12: 69,824,598	I517L	possibly damaging	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mlkl	C	G	8: 111,319,716		probably null	Het
Mllt1	A	G	17: 56,902,630	M160T	probably benign	Het
Mmp15	G	A	8: 95,368,196	A233T	possibly damaging	Het
Moxd2	C	A	6: 40,891,603	T23N	probably benign	Het
Nop53	C	A	7: 15,942,887	K100N	probably benign	Het
Nrg1	C	A	8: 31,918,200	E2*	probably null	Het
Olfr654	T	A	7: 104,588,489	H228Q	probably benign	Het
Pank4	A	G	4: 154,974,634	D408G	possibly damaging	Het
Pcdhb10	T	C	18: 37,411,942	W24R	probably benign	Het
Pcm1	C	T	8: 41,287,738	T968I	probably damaging	Het
Pkib	G	T	10: 57,708,150	M19I	probably benign	Het
Ppy	A	G	11: 102,100,519		probably null	Het
Prdx3	A	C	19: 60,873,183	C39W	possibly damaging	Het
Qrfpr	T	G	3: 36,221,924	N106H	probably benign	Het
Rai14	G	A	15: 10,575,690	T394M	possibly damaging	Het
Ralgapa2	A	T	2: 146,346,749	L1371Q	probably benign	Het
Rbm12	A	G	2: 156,097,128	L408P	probably damaging	Het
Rdx	T	C	9: 52,065,874	I141T	probably benign	Het
Reep1	T	A	6: 71,708,001	V11E	possibly damaging	Het
Sall4	A	G	2: 168,750,427	S936P	probably damaging	Het
Serac1	A	G	17: 6,051,790	M403T	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc35g2	T	G	9: 100,553,496	I41L	probably benign	Het
Slc39a12	G	A	2: 14,400,323	S242N	probably benign	Het
Slc9a2	T	A	1: 40,761,916	D535E	probably damaging	Het
Spata31d1a	G	T	13: 59,701,645	P890T	probably damaging	Het
Sync	A	G	4: 129,293,439	Q88R	probably benign	Het
Tdrp	A	G	8: 13,974,527		probably benign	Het
Tg	G	T	15: 66,693,319	C1170F	probably damaging	Het
Tnks	A	T	8: 34,851,783	D781E	probably benign	Het
Tnp2	T	A	16: 10,788,343	T87S	possibly damaging	Het
Tpp2	T	C	1: 43,971,715	V554A	probably benign	Het
Traf3ip2	T	C	10: 39,645,739	I431T	probably damaging	Het
Trav9d-4	A	T	14: 52,983,801	H84L	probably damaging	Het
Vmn2r42	T	A	7: 8,184,277	Y782F	probably damaging	Het
Vwf	T	C	6: 125,570,604	S231P	probably damaging	Het
Wdr83os	A	G	8: 85,081,867	S83G	probably damaging	Het
Wdr91	T	A	6: 34,908,299	Q109L	probably damaging	Het
Znrf4	A	G	17: 56,511,864	C148R	possibly damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2060:Igf2r	UTSW	17	12701319	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAGGCAGATGGAAGCTTGC -3'
(R):5'- TCATTTGGAACTACGAATGCCTGTG -3'

Sequencing Primer
(F):5'- CTCCTCCCGAGTTAGAGAAATGTG -3'
(R):5'- ACTACGAATGCCTGTGTGATAGC -3'

Posted On

2015-11-11