Incidental Mutation 'R4760:Pcdhb10'
ID356849
Institutional Source Beutler Lab
Gene Symbol Pcdhb10
Ensembl Gene ENSMUSG00000045657
Gene Nameprotocadherin beta 10
SynonymsPcdhb5D, PcdhbJ
MMRRC Submission 041974-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4760 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37411664-37414514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37411942 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 24 (W24R)
Ref Sequence ENSEMBL: ENSMUSP00000056420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051126] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051126
AA Change: W24R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000056420
Gene: ENSMUSG00000045657
AA Change: W24R

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 5.5e-33 PFAM
CA 155 240 5.59e-23 SMART
CA 264 344 5.17e-27 SMART
CA 367 448 5.59e-23 SMART
CA 472 558 6.62e-25 SMART
CA 588 669 2.03e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,721,305 M723K probably benign Het
A530053G22Rik A G 6: 60,402,101 noncoding transcript Het
Abcc2 A T 19: 43,810,481 Y512F probably benign Het
Adgrb1 T A 15: 74,571,463 I51N probably damaging Het
Adhfe1 A G 1: 9,563,523 Y332C probably damaging Het
Ambn C T 5: 88,467,707 L317F probably damaging Het
Amn1 T C 6: 149,185,113 Y17C probably benign Het
Apoa5 T C 9: 46,270,295 V223A probably damaging Het
BC048403 T C 10: 121,740,007 V11A probably damaging Het
Best3 A T 10: 117,024,794 H653L probably benign Het
Btnl2 C A 17: 34,363,195 S245Y probably damaging Het
Camk1d A G 2: 5,362,056 L116P probably damaging Het
Catsperg2 T A 7: 29,705,635 D698V probably damaging Het
Cd33 T C 7: 43,529,495 T307A probably benign Het
Cdk8 C T 5: 146,292,666 S230L probably benign Het
Cfap69 C T 5: 5,646,939 C119Y probably damaging Het
Chat T C 14: 32,453,737 N122S probably benign Het
Col20a1 A T 2: 180,984,403 probably benign Het
Cyp2j9 A T 4: 96,568,791 L481Q probably damaging Het
Dab1 A C 4: 104,732,145 S550R probably damaging Het
Dlgap2 A C 8: 14,773,380 Q533P probably damaging Het
Eif4g3 A T 4: 138,084,318 Q31L possibly damaging Het
Ets2 G A 16: 95,719,043 V438M probably damaging Het
Eva1c G A 16: 90,904,250 D258N probably benign Het
Fastkd2 A G 1: 63,745,886 H477R probably benign Het
Fga T G 3: 83,031,514 S399A probably benign Het
Fmo4 T A 1: 162,809,827 E32V probably damaging Het
Gm13083 G A 4: 143,617,231 R367K probably benign Het
Gm1840 G A 8: 5,640,473 noncoding transcript Het
Gm7204 T A 16: 48,218,688 noncoding transcript Het
Hhipl1 A G 12: 108,320,077 I548V probably damaging Het
Hsfy2 T C 1: 56,637,190 T63A probably benign Het
Igf2r A G 17: 12,703,465 V1254A possibly damaging Het
Ighv8-4 A T 12: 115,024,047 D110E probably damaging Het
Igkv14-130 T C 6: 67,791,462 S101P probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Ipo5 T C 14: 120,941,642 V779A probably benign Het
Itpr1 C T 6: 108,349,632 T105I probably benign Het
Kalrn T C 16: 34,198,487 M670V probably damaging Het
Kdm8 T A 7: 125,455,259 probably null Het
L3hypdh T C 12: 72,077,242 I281V probably benign Het
Lins1 T G 7: 66,714,687 probably benign Het
Map4k5 T A 12: 69,824,598 I517L possibly damaging Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mlkl C G 8: 111,319,716 probably null Het
Mllt1 A G 17: 56,902,630 M160T probably benign Het
Mmp15 G A 8: 95,368,196 A233T possibly damaging Het
Moxd2 C A 6: 40,891,603 T23N probably benign Het
Nop53 C A 7: 15,942,887 K100N probably benign Het
Nrg1 C A 8: 31,918,200 E2* probably null Het
Olfr654 T A 7: 104,588,489 H228Q probably benign Het
Pank4 A G 4: 154,974,634 D408G possibly damaging Het
Pcm1 C T 8: 41,287,738 T968I probably damaging Het
Pkib G T 10: 57,708,150 M19I probably benign Het
Ppy A G 11: 102,100,519 probably null Het
Prdx3 A C 19: 60,873,183 C39W possibly damaging Het
Qrfpr T G 3: 36,221,924 N106H probably benign Het
Rai14 G A 15: 10,575,690 T394M possibly damaging Het
Ralgapa2 A T 2: 146,346,749 L1371Q probably benign Het
Rbm12 A G 2: 156,097,128 L408P probably damaging Het
Rdx T C 9: 52,065,874 I141T probably benign Het
Reep1 T A 6: 71,708,001 V11E possibly damaging Het
Sall4 A G 2: 168,750,427 S936P probably damaging Het
Serac1 A G 17: 6,051,790 M403T possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc35g2 T G 9: 100,553,496 I41L probably benign Het
Slc39a12 G A 2: 14,400,323 S242N probably benign Het
Slc9a2 T A 1: 40,761,916 D535E probably damaging Het
Spata31d1a G T 13: 59,701,645 P890T probably damaging Het
Sync A G 4: 129,293,439 Q88R probably benign Het
Tdrp A G 8: 13,974,527 probably benign Het
Tg G T 15: 66,693,319 C1170F probably damaging Het
Tnks A T 8: 34,851,783 D781E probably benign Het
Tnp2 T A 16: 10,788,343 T87S possibly damaging Het
Tpp2 T C 1: 43,971,715 V554A probably benign Het
Traf3ip2 T C 10: 39,645,739 I431T probably damaging Het
Trav9d-4 A T 14: 52,983,801 H84L probably damaging Het
Vmn2r42 T A 7: 8,184,277 Y782F probably damaging Het
Vwf T C 6: 125,570,604 S231P probably damaging Het
Wdr83os A G 8: 85,081,867 S83G probably damaging Het
Wdr91 T A 6: 34,908,299 Q109L probably damaging Het
Znrf4 A G 17: 56,511,864 C148R possibly damaging Het
Other mutations in Pcdhb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Pcdhb10 APN 18 37412195 missense probably damaging 0.96
IGL01383:Pcdhb10 APN 18 37413275 missense probably benign 0.14
IGL01765:Pcdhb10 APN 18 37414019 missense probably benign 0.00
IGL02240:Pcdhb10 APN 18 37412402 missense possibly damaging 0.90
IGL02548:Pcdhb10 APN 18 37412690 missense probably benign 0.00
IGL02563:Pcdhb10 APN 18 37413073 missense probably benign 0.26
IGL02598:Pcdhb10 APN 18 37413781 missense possibly damaging 0.89
IGL02711:Pcdhb10 APN 18 37412726 missense possibly damaging 0.56
IGL02813:Pcdhb10 APN 18 37413762 missense possibly damaging 0.94
IGL02893:Pcdhb10 APN 18 37413634 missense probably damaging 1.00
IGL03288:Pcdhb10 APN 18 37413305 missense probably damaging 1.00
IGL03310:Pcdhb10 APN 18 37412321 missense probably damaging 0.97
R0004:Pcdhb10 UTSW 18 37411959 missense probably benign
R0004:Pcdhb10 UTSW 18 37411959 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0389:Pcdhb10 UTSW 18 37412432 missense probably damaging 1.00
R0443:Pcdhb10 UTSW 18 37412432 missense probably damaging 1.00
R0480:Pcdhb10 UTSW 18 37413099 missense probably damaging 1.00
R1218:Pcdhb10 UTSW 18 37413161 missense probably damaging 1.00
R1448:Pcdhb10 UTSW 18 37412503 missense possibly damaging 0.89
R1737:Pcdhb10 UTSW 18 37412956 missense probably benign 0.01
R2092:Pcdhb10 UTSW 18 37414187 missense probably benign 0.00
R2277:Pcdhb10 UTSW 18 37412624 missense possibly damaging 0.82
R2363:Pcdhb10 UTSW 18 37414137 nonsense probably null
R3826:Pcdhb10 UTSW 18 37412417 missense probably damaging 1.00
R4372:Pcdhb10 UTSW 18 37413313 missense possibly damaging 0.95
R4412:Pcdhb10 UTSW 18 37414141 frame shift probably null
R4941:Pcdhb10 UTSW 18 37412834 missense probably benign 0.29
R5271:Pcdhb10 UTSW 18 37413169 missense probably benign 0.44
R5643:Pcdhb10 UTSW 18 37413166 missense possibly damaging 0.63
R5851:Pcdhb10 UTSW 18 37412758 missense probably benign 0.00
R6089:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6125:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6189:Pcdhb10 UTSW 18 37412403 missense probably damaging 0.99
R6414:Pcdhb10 UTSW 18 37413845 missense possibly damaging 0.95
R6731:Pcdhb10 UTSW 18 37413476 missense probably benign 0.02
R6999:Pcdhb10 UTSW 18 37413118 missense probably damaging 1.00
R7019:Pcdhb10 UTSW 18 37413003 missense probably damaging 1.00
R7317:Pcdhb10 UTSW 18 37413026 missense possibly damaging 0.67
R7554:Pcdhb10 UTSW 18 37411882 missense probably benign
X0024:Pcdhb10 UTSW 18 37412998 missense probably benign 0.12
X0036:Pcdhb10 UTSW 18 37411973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTTTCTACTCCCTAGAAGAAG -3'
(R):5'- AATTCCCAGTCTCTGCATCCAG -3'

Sequencing Primer
(F):5'- AATCTCCGCGGGCAGTAAGAC -3'
(R):5'- GCTGCAAGAGCTCTTTGTTTC -3'
Posted On2015-11-11