Mutagenetix > Incidental Mutation

Incidental Mutation 'R0403:Prkg2'

35685

Institutional Source

Beutler Lab

Gene Symbol

Prkg2

Ensembl Gene

ENSMUSG00000029334

Gene Name

protein kinase, cGMP-dependent, type II

Synonyms

Prkgr2, cGK-II

MMRRC Submission

038608-MU

Accession Numbers

NCBI RefSeq: NM_008926.4; MGI: 108173

Is this an essential gene?

Probably non essential (E-score: 0.223) question?

Stock #

R0403 (G1)

Quality Score

162

Status

Validated

Chromosome

Chromosomal Location

98929773-99037351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98994645 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 210 (E210G)

Ref Sequence

ENSEMBL: ENSMUSP00000031277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031277] [ENSMUST00000161490]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031277
AA Change: E210G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031277
Gene: ENSMUSG00000029334
AA Change: E210G

Domain	Start	End	E-Value	Type
coiled coil region	19	85	N/A	INTRINSIC
cNMP	168	284	2.82e-19	SMART
cNMP	286	409	3.02e-28	SMART
S_TKc	424	682	9.46e-75	SMART
S_TK_X	683	733	9.83e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161490
AA Change: E210G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000124963
Gene: ENSMUSG00000029334
AA Change: E210G

Domain	Start	End	E-Value	Type
coiled coil region	19	85	N/A	INTRINSIC
cNMP	168	284	2.82e-19	SMART
cNMP	286	409	3.02e-28	SMART
S_TKc	453	711	1.19e-89	SMART
S_TK_X	712	762	9.83e-4	SMART

Meta Mutation Damage Score

0.7671

Coding Region Coverage

1x: 98.0%
3x: 96.8%
10x: 93.2%
20x: 83.7%

Validation Efficiency

97% (110/113)

MGI Phenotype

Strain: 24494704
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein plays a role in the regulation of fluid balance in the intestine. A similar protein in mouse is thought to regulate differentiation and proliferation of cells in the colon. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice exhibit dwarfism, with abnormal skull morphology and short limbs and vertebrae. Defects in axial organization of the growth plates was evident as mice aged. Digestive secretion in response to enterotoxin was reduced. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	A	G	11: 105,973,880		probably null	Het
Adgrg3	C	T	8: 95,036,922	L284F	probably benign	Het
Alkbh8	T	A	9: 3,385,469	V587E	probably damaging	Het
Ap4b1	T	A	3: 103,818,839	C244S	probably damaging	Het
Ap4b1	T	A	3: 103,821,396	M590K	probably benign	Het
Arhgap15	C	T	2: 44,063,766	T168I	probably damaging	Het
Arntl2	T	A	6: 146,822,655	H348Q	probably damaging	Het
Atp8b1	A	G	18: 64,540,310	V997A	probably damaging	Het
Atrn	G	A	2: 130,906,859	C100Y	probably damaging	Het
Baiap2l2	C	A	15: 79,271,216	A151S	probably benign	Het
Baz2b	A	T	2: 59,969,377	D199E	possibly damaging	Het
Cblb	A	G	16: 52,152,626	D440G	probably benign	Het
Cdon	T	C	9: 35,473,500	V694A	probably benign	Het
Cep250	A	T	2: 155,992,349	R2065W	probably damaging	Het
Ces2b	G	T	8: 104,833,945	A131S	probably damaging	Het
Chrna9	A	T	5: 65,967,892	T59S	possibly damaging	Het
Cog3	T	A	14: 75,742,327		probably benign	Het
Cpa1	G	A	6: 30,641,857	V227I	probably benign	Het
Cyp3a25	A	T	5: 145,998,513	C98S	probably damaging	Het
D8Ertd738e	C	T	8: 84,249,601		probably null	Het
Ddx60	A	G	8: 61,994,541		probably benign	Het
Dhx16	T	C	17: 35,883,050		probably null	Het
Dnah9	T	A	11: 66,084,789	Q1478L	possibly damaging	Het
Dock10	T	C	1: 80,524,070	Y1434C	possibly damaging	Het
Enpp3	T	A	10: 24,804,436	D325V	probably damaging	Het
Entpd6	C	A	2: 150,760,170	T194K	possibly damaging	Het
Fam208b	A	T	13: 3,582,052	Y816*	probably null	Het
Fat2	A	T	11: 55,270,349	V3185E	probably benign	Het
Flrt1	A	G	19: 7,095,919	L421P	probably benign	Het
Fmn2	A	T	1: 174,694,278	Q1292L	probably damaging	Het
Fndc1	T	C	17: 7,775,588		probably null	Het
Fndc1	T	C	17: 7,753,723	D1459G	probably damaging	Het
Fzr1	A	G	10: 81,369,368	S265P	possibly damaging	Het
Gm13119	A	G	4: 144,362,646	N178S	probably benign	Het
Gm14085	T	C	2: 122,521,854	L364S	probably damaging	Het
Gpr142	G	A	11: 114,806,029	V134M	probably damaging	Het
Grid2ip	G	T	5: 143,357,620	V24L	possibly damaging	Het
Herc2	G	A	7: 56,159,417	R2555H	probably damaging	Het
Hpdl	A	T	4: 116,820,479	Y262N	possibly damaging	Het
Htr3a	A	G	9: 48,908,659	V57A	probably damaging	Het
Igfbp7	T	C	5: 77,355,591	I186V	probably benign	Het
Itga2b	C	T	11: 102,467,326		probably null	Het
Itgae	A	C	11: 73,123,183	D736A	possibly damaging	Het
Itpkc	T	A	7: 27,208,345	M645L	probably benign	Het
Jchain	T	C	5: 88,521,378	R139G	probably benign	Het
Kif13a	A	G	13: 46,791,401	V908A	probably damaging	Het
Kif1b	T	A	4: 149,181,967	K389*	probably null	Het
Klhl12	T	C	1: 134,485,856	Y360H	possibly damaging	Het
Knop1	G	A	7: 118,853,053	R148W	probably damaging	Het
Lpar1	T	A	4: 58,487,191	N27Y	probably damaging	Het
Lpar2	T	A	8: 69,824,152	V197D	probably damaging	Het
Lrrc74a	A	G	12: 86,740,979	N128S	probably damaging	Het
Lum	G	T	10: 97,572,043	V337F	probably benign	Het
Mag	T	C	7: 30,906,980	D344G	probably damaging	Het
Maip1	G	A	1: 57,407,196	A142T	probably benign	Het
Mlh3	A	G	12: 85,268,968	V148A	possibly damaging	Het
Nav3	A	G	10: 109,767,103	V1195A	probably damaging	Het
Ncor2	A	G	5: 125,033,337	S868P	possibly damaging	Het
Nek1	A	G	8: 61,106,855	E907G	probably damaging	Het
Nfam1	G	A	15: 83,016,379	T134I	probably benign	Het
Nr0b2	T	C	4: 133,553,759	V112A	probably damaging	Het
Nrp1	A	G	8: 128,457,969	N365S	probably damaging	Het
Nrsn2	T	C	2: 152,369,790	Y107C	probably damaging	Het
Ntng1	G	A	3: 109,934,611	A282V	probably damaging	Het
Nxf1	T	C	19: 8,765,028	I337T	probably damaging	Het
Obscn	C	T	11: 59,076,540	G479D	probably damaging	Het
Olfr45	T	C	7: 140,691,309	S135P	possibly damaging	Het
Oprd1	T	A	4: 132,113,768	D293V	probably benign	Het
P3h2	T	G	16: 25,969,950	N586H	possibly damaging	Het
Pcid2	T	C	8: 13,085,367	Y214C	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Ppic	C	A	18: 53,411,071	G81W	probably damaging	Het
Ppp2r1a	C	A	17: 20,957,041	P246T	probably damaging	Het
Ppp4r4	T	G	12: 103,584,102	S46A	probably benign	Het
Prkce	A	G	17: 86,168,653	T21A	probably damaging	Het
Prss35	A	G	9: 86,756,037	M287V	probably damaging	Het
Psd	G	A	19: 46,320,972		probably benign	Het
Ptch2	A	T	4: 117,110,839	K843*	probably null	Het
Rab44	C	A	17: 29,145,261	T603K	probably damaging	Het
Rasal3	T	A	17: 32,392,790		probably null	Het
Rbbp6	A	G	7: 122,992,296	T526A	probably damaging	Het
Ros1	A	T	10: 52,143,438		probably benign	Het
Sec24b	T	A	3: 129,989,676	L1104F	possibly damaging	Het
Sec24b	A	G	3: 129,999,534	S685P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Setmar	A	T	6: 108,075,962	H139L	probably benign	Het
Slc4a7	T	C	14: 14,766,808	V710A	probably benign	Het
Smarcc1	T	A	9: 110,237,808		probably null	Het
Smchd1	G	A	17: 71,394,902	L1032F	probably damaging	Het
Speg	T	C	1: 75,430,784		probably benign	Het
Tcea1	C	G	1: 4,889,503	R134G	probably benign	Het
Tchhl1	C	T	3: 93,471,029	Q347*	probably null	Het
Tecrl	A	T	5: 83,354,758		probably benign	Het
Tepsin	T	C	11: 120,093,682		probably benign	Het
Tmem40	G	A	6: 115,733,985		probably benign	Het
Tpr	G	A	1: 150,407,414		probably benign	Het
Ttll12	A	T	15: 83,580,658		probably benign	Het
Ttn	T	A	2: 76,909,608	D3529V	probably benign	Het
Usp34	T	A	11: 23,333,838	H177Q	possibly damaging	Het
Vsig10	T	A	5: 117,338,461	S327T	probably benign	Het
Zbtb4	T	A	11: 69,777,639	M396K	probably damaging	Het
Zfp352	C	T	4: 90,225,009	T462I	possibly damaging	Het
Zfp385b	T	C	2: 77,476,845	M145V	probably damaging	Het
Zfp780b	C	A	7: 27,971,689	V65F	possibly damaging	Het

Other mutations in Prkg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Prkg2	APN	5	99024541	missense	probably benign	0.00
IGL01063:Prkg2	APN	5	98969936	critical splice donor site	probably null
IGL02060:Prkg2	APN	5	99024515	missense	probably benign	0.32
IGL02666:Prkg2	APN	5	98997519	splice site	probably benign
IGL02992:Prkg2	APN	5	99024506	missense	probably benign
IGL03040:Prkg2	APN	5	98973107	critical splice donor site	probably null
devito	UTSW	5	98966510	critical splice donor site	probably null
Goldwyn	UTSW	5	98942208	missense	possibly damaging	0.86
kilmer	UTSW	5	98947474	missense	probably damaging	1.00
Pulp	UTSW	5	98976462	missense	possibly damaging	0.92
travolta	UTSW	5	98969980	missense	probably damaging	1.00
P0005:Prkg2	UTSW	5	98969947	missense	probably damaging	1.00
R0044:Prkg2	UTSW	5	98973130	missense	probably damaging	0.98
R0044:Prkg2	UTSW	5	98973130	missense	probably damaging	0.98
R0115:Prkg2	UTSW	5	98994655	splice site	probably null
R0452:Prkg2	UTSW	5	98997520	splice site	probably benign
R0481:Prkg2	UTSW	5	98994655	splice site	probably null
R1194:Prkg2	UTSW	5	98971926	missense	probably benign	0.00
R1534:Prkg2	UTSW	5	98994561	missense	probably damaging	1.00
R1861:Prkg2	UTSW	5	98947416	missense	probably damaging	1.00
R2010:Prkg2	UTSW	5	99024805	missense	probably benign
R2031:Prkg2	UTSW	5	99024451	missense	possibly damaging	0.85
R2176:Prkg2	UTSW	5	98966509	splice site	probably benign
R3607:Prkg2	UTSW	5	98947377	missense	probably damaging	1.00
R3958:Prkg2	UTSW	5	98997495	missense	possibly damaging	0.84
R3960:Prkg2	UTSW	5	98997495	missense	possibly damaging	0.84
R4012:Prkg2	UTSW	5	98979815	missense	possibly damaging	0.93
R4794:Prkg2	UTSW	5	98966633	missense	probably damaging	1.00
R4840:Prkg2	UTSW	5	98981143	missense	probably benign	0.03
R4867:Prkg2	UTSW	5	99024709	missense	probably benign	0.21
R5182:Prkg2	UTSW	5	99024709	missense	probably benign	0.21
R5226:Prkg2	UTSW	5	98976462	missense	possibly damaging	0.92
R5274:Prkg2	UTSW	5	98969991	missense	probably damaging	1.00
R5416:Prkg2	UTSW	5	98943467	missense	probably benign	0.05
R5531:Prkg2	UTSW	5	98967734	missense	probably damaging	1.00
R5619:Prkg2	UTSW	5	98988297	missense	probably damaging	1.00
R6264:Prkg2	UTSW	5	98934364	missense	probably benign	0.22
R6925:Prkg2	UTSW	5	98966510	critical splice donor site	probably null
R7971:Prkg2	UTSW	5	98932014	missense	probably damaging	1.00
R8210:Prkg2	UTSW	5	98966534	missense	probably damaging	1.00
R8788:Prkg2	UTSW	5	98969980	missense	probably damaging	1.00
R8824:Prkg2	UTSW	5	98942208	missense	possibly damaging	0.86
R8825:Prkg2	UTSW	5	98942184	missense	probably benign	0.02
R8932:Prkg2	UTSW	5	98947440	missense	possibly damaging	0.80
R8950:Prkg2	UTSW	5	98971956	missense	possibly damaging	0.54
R9026:Prkg2	UTSW	5	98966527	missense	probably benign
R9210:Prkg2	UTSW	5	98947474	missense	probably damaging	1.00
R9363:Prkg2	UTSW	5	99024398	missense	probably benign	0.30
R9627:Prkg2	UTSW	5	98932010	makesense	probably null
Z1088:Prkg2	UTSW	5	99024804	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCAGTGGTGATTCTTAGCAGCTTC -3'
(R):5'- CCTCATGGCAAGAGCTATGCAGTG -3'

Sequencing Primer
(F):5'- GTGATTCTTAGCAGCTTCTCTCC -3'
(R):5'- ccaaagtttacatagcatctagcc -3'

Posted On

2013-05-09