Incidental Mutation 'R0403:Prkg2'
ID 35685
Institutional Source Beutler Lab
Gene Symbol Prkg2
Ensembl Gene ENSMUSG00000029334
Gene Name protein kinase, cGMP-dependent, type II
Synonyms Prkgr2, cGK-II
MMRRC Submission 038608-MU
Accession Numbers

NCBI RefSeq: NM_008926.4; MGI: 108173

Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock # R0403 (G1)
Quality Score 162
Status Validated
Chromosome 5
Chromosomal Location 98929773-99037351 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98994645 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 210 (E210G)
Ref Sequence ENSEMBL: ENSMUSP00000031277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031277] [ENSMUST00000161490]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031277
AA Change: E210G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031277
Gene: ENSMUSG00000029334
AA Change: E210G

coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 424 682 9.46e-75 SMART
S_TK_X 683 733 9.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161490
AA Change: E210G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124963
Gene: ENSMUSG00000029334
AA Change: E210G

coiled coil region 19 85 N/A INTRINSIC
cNMP 168 284 2.82e-19 SMART
cNMP 286 409 3.02e-28 SMART
S_TKc 453 711 1.19e-89 SMART
S_TK_X 712 762 9.83e-4 SMART
Meta Mutation Damage Score 0.7671 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype Strain: 24494704
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family of proteins. The encoded protein plays a role in the regulation of fluid balance in the intestine. A similar protein in mouse is thought to regulate differentiation and proliferation of cells in the colon. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice exhibit dwarfism, with abnormal skull morphology and short limbs and vertebrae. Defects in axial organization of the growth plates was evident as mice aged. Digestive secretion in response to enterotoxin was reduced. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,973,880 probably null Het
Adgrg3 C T 8: 95,036,922 L284F probably benign Het
Alkbh8 T A 9: 3,385,469 V587E probably damaging Het
Ap4b1 T A 3: 103,818,839 C244S probably damaging Het
Ap4b1 T A 3: 103,821,396 M590K probably benign Het
Arhgap15 C T 2: 44,063,766 T168I probably damaging Het
Arntl2 T A 6: 146,822,655 H348Q probably damaging Het
Atp8b1 A G 18: 64,540,310 V997A probably damaging Het
Atrn G A 2: 130,906,859 C100Y probably damaging Het
Baiap2l2 C A 15: 79,271,216 A151S probably benign Het
Baz2b A T 2: 59,969,377 D199E possibly damaging Het
Cblb A G 16: 52,152,626 D440G probably benign Het
Cdon T C 9: 35,473,500 V694A probably benign Het
Cep250 A T 2: 155,992,349 R2065W probably damaging Het
Ces2b G T 8: 104,833,945 A131S probably damaging Het
Chrna9 A T 5: 65,967,892 T59S possibly damaging Het
Cog3 T A 14: 75,742,327 probably benign Het
Cpa1 G A 6: 30,641,857 V227I probably benign Het
Cyp3a25 A T 5: 145,998,513 C98S probably damaging Het
D8Ertd738e C T 8: 84,249,601 probably null Het
Ddx60 A G 8: 61,994,541 probably benign Het
Dhx16 T C 17: 35,883,050 probably null Het
Dnah9 T A 11: 66,084,789 Q1478L possibly damaging Het
Dock10 T C 1: 80,524,070 Y1434C possibly damaging Het
Enpp3 T A 10: 24,804,436 D325V probably damaging Het
Entpd6 C A 2: 150,760,170 T194K possibly damaging Het
Fam208b A T 13: 3,582,052 Y816* probably null Het
Fat2 A T 11: 55,270,349 V3185E probably benign Het
Flrt1 A G 19: 7,095,919 L421P probably benign Het
Fmn2 A T 1: 174,694,278 Q1292L probably damaging Het
Fndc1 T C 17: 7,775,588 probably null Het
Fndc1 T C 17: 7,753,723 D1459G probably damaging Het
Fzr1 A G 10: 81,369,368 S265P possibly damaging Het
Gm13119 A G 4: 144,362,646 N178S probably benign Het
Gm14085 T C 2: 122,521,854 L364S probably damaging Het
Gpr142 G A 11: 114,806,029 V134M probably damaging Het
Grid2ip G T 5: 143,357,620 V24L possibly damaging Het
Herc2 G A 7: 56,159,417 R2555H probably damaging Het
Hpdl A T 4: 116,820,479 Y262N possibly damaging Het
Htr3a A G 9: 48,908,659 V57A probably damaging Het
Igfbp7 T C 5: 77,355,591 I186V probably benign Het
Itga2b C T 11: 102,467,326 probably null Het
Itgae A C 11: 73,123,183 D736A possibly damaging Het
Itpkc T A 7: 27,208,345 M645L probably benign Het
Jchain T C 5: 88,521,378 R139G probably benign Het
Kif13a A G 13: 46,791,401 V908A probably damaging Het
Kif1b T A 4: 149,181,967 K389* probably null Het
Klhl12 T C 1: 134,485,856 Y360H possibly damaging Het
Knop1 G A 7: 118,853,053 R148W probably damaging Het
Lpar1 T A 4: 58,487,191 N27Y probably damaging Het
Lpar2 T A 8: 69,824,152 V197D probably damaging Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Lum G T 10: 97,572,043 V337F probably benign Het
Mag T C 7: 30,906,980 D344G probably damaging Het
Maip1 G A 1: 57,407,196 A142T probably benign Het
Mlh3 A G 12: 85,268,968 V148A possibly damaging Het
Nav3 A G 10: 109,767,103 V1195A probably damaging Het
Ncor2 A G 5: 125,033,337 S868P possibly damaging Het
Nek1 A G 8: 61,106,855 E907G probably damaging Het
Nfam1 G A 15: 83,016,379 T134I probably benign Het
Nr0b2 T C 4: 133,553,759 V112A probably damaging Het
Nrp1 A G 8: 128,457,969 N365S probably damaging Het
Nrsn2 T C 2: 152,369,790 Y107C probably damaging Het
Ntng1 G A 3: 109,934,611 A282V probably damaging Het
Nxf1 T C 19: 8,765,028 I337T probably damaging Het
Obscn C T 11: 59,076,540 G479D probably damaging Het
Olfr45 T C 7: 140,691,309 S135P possibly damaging Het
Oprd1 T A 4: 132,113,768 D293V probably benign Het
P3h2 T G 16: 25,969,950 N586H possibly damaging Het
Pcid2 T C 8: 13,085,367 Y214C probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Ppic C A 18: 53,411,071 G81W probably damaging Het
Ppp2r1a C A 17: 20,957,041 P246T probably damaging Het
Ppp4r4 T G 12: 103,584,102 S46A probably benign Het
Prkce A G 17: 86,168,653 T21A probably damaging Het
Prss35 A G 9: 86,756,037 M287V probably damaging Het
Psd G A 19: 46,320,972 probably benign Het
Ptch2 A T 4: 117,110,839 K843* probably null Het
Rab44 C A 17: 29,145,261 T603K probably damaging Het
Rasal3 T A 17: 32,392,790 probably null Het
Rbbp6 A G 7: 122,992,296 T526A probably damaging Het
Ros1 A T 10: 52,143,438 probably benign Het
Sec24b T A 3: 129,989,676 L1104F possibly damaging Het
Sec24b A G 3: 129,999,534 S685P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setmar A T 6: 108,075,962 H139L probably benign Het
Slc4a7 T C 14: 14,766,808 V710A probably benign Het
Smarcc1 T A 9: 110,237,808 probably null Het
Smchd1 G A 17: 71,394,902 L1032F probably damaging Het
Speg T C 1: 75,430,784 probably benign Het
Tcea1 C G 1: 4,889,503 R134G probably benign Het
Tchhl1 C T 3: 93,471,029 Q347* probably null Het
Tecrl A T 5: 83,354,758 probably benign Het
Tepsin T C 11: 120,093,682 probably benign Het
Tmem40 G A 6: 115,733,985 probably benign Het
Tpr G A 1: 150,407,414 probably benign Het
Ttll12 A T 15: 83,580,658 probably benign Het
Ttn T A 2: 76,909,608 D3529V probably benign Het
Usp34 T A 11: 23,333,838 H177Q possibly damaging Het
Vsig10 T A 5: 117,338,461 S327T probably benign Het
Zbtb4 T A 11: 69,777,639 M396K probably damaging Het
Zfp352 C T 4: 90,225,009 T462I possibly damaging Het
Zfp385b T C 2: 77,476,845 M145V probably damaging Het
Zfp780b C A 7: 27,971,689 V65F possibly damaging Het
Other mutations in Prkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Prkg2 APN 5 99024541 missense probably benign 0.00
IGL01063:Prkg2 APN 5 98969936 critical splice donor site probably null
IGL02060:Prkg2 APN 5 99024515 missense probably benign 0.32
IGL02666:Prkg2 APN 5 98997519 splice site probably benign
IGL02992:Prkg2 APN 5 99024506 missense probably benign
IGL03040:Prkg2 APN 5 98973107 critical splice donor site probably null
devito UTSW 5 98966510 critical splice donor site probably null
Goldwyn UTSW 5 98942208 missense possibly damaging 0.86
kilmer UTSW 5 98947474 missense probably damaging 1.00
Pulp UTSW 5 98976462 missense possibly damaging 0.92
travolta UTSW 5 98969980 missense probably damaging 1.00
P0005:Prkg2 UTSW 5 98969947 missense probably damaging 1.00
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0044:Prkg2 UTSW 5 98973130 missense probably damaging 0.98
R0115:Prkg2 UTSW 5 98994655 splice site probably null
R0452:Prkg2 UTSW 5 98997520 splice site probably benign
R0481:Prkg2 UTSW 5 98994655 splice site probably null
R1194:Prkg2 UTSW 5 98971926 missense probably benign 0.00
R1534:Prkg2 UTSW 5 98994561 missense probably damaging 1.00
R1861:Prkg2 UTSW 5 98947416 missense probably damaging 1.00
R2010:Prkg2 UTSW 5 99024805 missense probably benign
R2031:Prkg2 UTSW 5 99024451 missense possibly damaging 0.85
R2176:Prkg2 UTSW 5 98966509 splice site probably benign
R3607:Prkg2 UTSW 5 98947377 missense probably damaging 1.00
R3958:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R3960:Prkg2 UTSW 5 98997495 missense possibly damaging 0.84
R4012:Prkg2 UTSW 5 98979815 missense possibly damaging 0.93
R4794:Prkg2 UTSW 5 98966633 missense probably damaging 1.00
R4840:Prkg2 UTSW 5 98981143 missense probably benign 0.03
R4867:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5182:Prkg2 UTSW 5 99024709 missense probably benign 0.21
R5226:Prkg2 UTSW 5 98976462 missense possibly damaging 0.92
R5274:Prkg2 UTSW 5 98969991 missense probably damaging 1.00
R5416:Prkg2 UTSW 5 98943467 missense probably benign 0.05
R5531:Prkg2 UTSW 5 98967734 missense probably damaging 1.00
R5619:Prkg2 UTSW 5 98988297 missense probably damaging 1.00
R6264:Prkg2 UTSW 5 98934364 missense probably benign 0.22
R6925:Prkg2 UTSW 5 98966510 critical splice donor site probably null
R7971:Prkg2 UTSW 5 98932014 missense probably damaging 1.00
R8210:Prkg2 UTSW 5 98966534 missense probably damaging 1.00
R8788:Prkg2 UTSW 5 98969980 missense probably damaging 1.00
R8824:Prkg2 UTSW 5 98942208 missense possibly damaging 0.86
R8825:Prkg2 UTSW 5 98942184 missense probably benign 0.02
R8932:Prkg2 UTSW 5 98947440 missense possibly damaging 0.80
R8950:Prkg2 UTSW 5 98971956 missense possibly damaging 0.54
R9026:Prkg2 UTSW 5 98966527 missense probably benign
R9210:Prkg2 UTSW 5 98947474 missense probably damaging 1.00
R9363:Prkg2 UTSW 5 99024398 missense probably benign 0.30
R9627:Prkg2 UTSW 5 98932010 makesense probably null
Z1088:Prkg2 UTSW 5 99024804 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccaaagtttacatagcatctagcc -3'
Posted On 2013-05-09