Incidental Mutation 'R4760:Abcc2'
ID 356850
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene Name ATP-binding cassette, sub-family member 2
Synonyms Cmoat, Mrp2, multidrug resistance protein 2
MMRRC Submission 041974-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4760 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 43770747-43826771 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43798920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 512 (Y512F)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
AlphaFold Q8VI47
Predicted Effect probably benign
Transcript: ENSMUST00000026208
AA Change: Y512F

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: Y512F

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146737
Meta Mutation Damage Score 0.1367 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530053G22Rik A G 6: 60,379,086 (GRCm39) noncoding transcript Het
Adgrb1 T A 15: 74,443,312 (GRCm39) I51N probably damaging Het
Adhfe1 A G 1: 9,633,748 (GRCm39) Y332C probably damaging Het
Ambn C T 5: 88,615,566 (GRCm39) L317F probably damaging Het
Amn1 T C 6: 149,086,611 (GRCm39) Y17C probably benign Het
Apoa5 T C 9: 46,181,593 (GRCm39) V223A probably damaging Het
Best3 A T 10: 116,860,699 (GRCm39) H653L probably benign Het
Btnl2 C A 17: 34,582,169 (GRCm39) S245Y probably damaging Het
Camk1d A G 2: 5,366,867 (GRCm39) L116P probably damaging Het
Catsperg2 T A 7: 29,405,060 (GRCm39) D698V probably damaging Het
Cd33 T C 7: 43,178,919 (GRCm39) T307A probably benign Het
Cdk8 C T 5: 146,229,476 (GRCm39) S230L probably benign Het
Cfap69 C T 5: 5,696,939 (GRCm39) C119Y probably damaging Het
Chat T C 14: 32,175,694 (GRCm39) N122S probably benign Het
Col20a1 A T 2: 180,626,196 (GRCm39) probably benign Het
Cyp2j9 A T 4: 96,457,028 (GRCm39) L481Q probably damaging Het
Dab1 A C 4: 104,589,342 (GRCm39) S550R probably damaging Het
Dlgap2 A C 8: 14,823,380 (GRCm39) Q533P probably damaging Het
Eif4g3 A T 4: 137,811,629 (GRCm39) Q31L possibly damaging Het
Ets2 G A 16: 95,520,087 (GRCm39) V438M probably damaging Het
Eva1c G A 16: 90,701,138 (GRCm39) D258N probably benign Het
Fastkd2 A G 1: 63,785,045 (GRCm39) H477R probably benign Het
Fga T G 3: 82,938,821 (GRCm39) S399A probably benign Het
Fmo4 T A 1: 162,637,396 (GRCm39) E32V probably damaging Het
Gm7204 T A 16: 48,039,051 (GRCm39) noncoding transcript Het
Gpi-ps G A 8: 5,690,473 (GRCm39) noncoding transcript Het
Hhipl1 A G 12: 108,286,336 (GRCm39) I548V probably damaging Het
Hsfy2 T C 1: 56,676,349 (GRCm39) T63A probably benign Het
Igf2r A G 17: 12,922,352 (GRCm39) V1254A possibly damaging Het
Ighv8-4 A T 12: 114,987,667 (GRCm39) D110E probably damaging Het
Igkv14-130 T C 6: 67,768,446 (GRCm39) S101P probably benign Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Ipo5 T C 14: 121,179,054 (GRCm39) V779A probably benign Het
Itpr1 C T 6: 108,326,593 (GRCm39) T105I probably benign Het
Kalrn T C 16: 34,018,857 (GRCm39) M670V probably damaging Het
Kdm8 T A 7: 125,054,431 (GRCm39) probably null Het
Kics2 T C 10: 121,575,912 (GRCm39) V11A probably damaging Het
L3hypdh T C 12: 72,124,016 (GRCm39) I281V probably benign Het
Lins1 T G 7: 66,364,435 (GRCm39) probably benign Het
Map4k5 T A 12: 69,871,372 (GRCm39) I517L possibly damaging Het
Marchf2 G T 17: 33,928,890 (GRCm39) T2K probably damaging Het
Mlkl C G 8: 112,046,348 (GRCm39) probably null Het
Mllt1 A G 17: 57,209,630 (GRCm39) M160T probably benign Het
Mmp15 G A 8: 96,094,824 (GRCm39) A233T possibly damaging Het
Moxd2 C A 6: 40,868,537 (GRCm39) T23N probably benign Het
Nop53 C A 7: 15,676,812 (GRCm39) K100N probably benign Het
Nrg1 C A 8: 32,408,228 (GRCm39) E2* probably null Het
Or52u1 T A 7: 104,237,696 (GRCm39) H228Q probably benign Het
Pank4 A G 4: 155,059,091 (GRCm39) D408G possibly damaging Het
Pcdhb10 T C 18: 37,544,995 (GRCm39) W24R probably benign Het
Pcm1 C T 8: 41,740,775 (GRCm39) T968I probably damaging Het
Pkib G T 10: 57,584,246 (GRCm39) M19I probably benign Het
Ppy A G 11: 101,991,345 (GRCm39) probably null Het
Pramel21 G A 4: 143,343,801 (GRCm39) R367K probably benign Het
Prdx3 A C 19: 60,861,621 (GRCm39) C39W possibly damaging Het
Qrfpr T G 3: 36,276,073 (GRCm39) N106H probably benign Het
Rai14 G A 15: 10,575,776 (GRCm39) T394M possibly damaging Het
Ralgapa2 A T 2: 146,188,669 (GRCm39) L1371Q probably benign Het
Rbm12 A G 2: 155,939,048 (GRCm39) L408P probably damaging Het
Rdx T C 9: 51,977,174 (GRCm39) I141T probably benign Het
Reep1 T A 6: 71,684,985 (GRCm39) V11E possibly damaging Het
Relch T A 1: 105,649,030 (GRCm39) M723K probably benign Het
Sall4 A G 2: 168,592,347 (GRCm39) S936P probably damaging Het
Serac1 A G 17: 6,102,065 (GRCm39) M403T possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc35g2 T G 9: 100,435,549 (GRCm39) I41L probably benign Het
Slc39a12 G A 2: 14,405,134 (GRCm39) S242N probably benign Het
Slc9a2 T A 1: 40,801,076 (GRCm39) D535E probably damaging Het
Spata31d1a G T 13: 59,849,459 (GRCm39) P890T probably damaging Het
Sync A G 4: 129,187,232 (GRCm39) Q88R probably benign Het
Tdrp A G 8: 14,024,527 (GRCm39) probably benign Het
Tg G T 15: 66,565,168 (GRCm39) C1170F probably damaging Het
Tnks A T 8: 35,318,937 (GRCm39) D781E probably benign Het
Tnp2 T A 16: 10,606,207 (GRCm39) T87S possibly damaging Het
Tpp2 T C 1: 44,010,875 (GRCm39) V554A probably benign Het
Traf3ip2 T C 10: 39,521,735 (GRCm39) I431T probably damaging Het
Trav9d-4 A T 14: 53,221,258 (GRCm39) H84L probably damaging Het
Vmn2r42 T A 7: 8,187,276 (GRCm39) Y782F probably damaging Het
Vwf T C 6: 125,547,567 (GRCm39) S231P probably damaging Het
Wdr83os A G 8: 85,808,496 (GRCm39) S83G probably damaging Het
Wdr91 T A 6: 34,885,234 (GRCm39) Q109L probably damaging Het
Znrf4 A G 17: 56,818,864 (GRCm39) C148R possibly damaging Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43,772,641 (GRCm39) missense probably benign 0.39
IGL01611:Abcc2 APN 19 43,815,068 (GRCm39) missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43,772,734 (GRCm39) missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43,810,189 (GRCm39) splice site probably benign
IGL02041:Abcc2 APN 19 43,772,674 (GRCm39) missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43,786,943 (GRCm39) missense probably benign
IGL02950:Abcc2 APN 19 43,814,406 (GRCm39) missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43,770,841 (GRCm39) utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43,772,743 (GRCm39) missense probably benign 0.00
loser UTSW 19 43,827,850 (GRCm39) utr 3 prime probably benign
nelson UTSW 19 43,792,178 (GRCm39) missense probably benign 0.07
Sore UTSW 19 43,786,633 (GRCm39) missense probably benign 0.22
BB002:Abcc2 UTSW 19 43,795,551 (GRCm39) missense probably benign 0.07
BB012:Abcc2 UTSW 19 43,795,551 (GRCm39) missense probably benign 0.07
PIT4453001:Abcc2 UTSW 19 43,792,221 (GRCm39) nonsense probably null
PIT4519001:Abcc2 UTSW 19 43,807,836 (GRCm39) missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43,815,053 (GRCm39) nonsense probably null
R0326:Abcc2 UTSW 19 43,814,386 (GRCm39) missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43,810,044 (GRCm39) splice site probably benign
R0558:Abcc2 UTSW 19 43,789,163 (GRCm39) missense probably benign 0.00
R0577:Abcc2 UTSW 19 43,807,840 (GRCm39) missense probably damaging 1.00
R0787:Abcc2 UTSW 19 43,786,955 (GRCm39) critical splice donor site probably null
R1189:Abcc2 UTSW 19 43,807,852 (GRCm39) missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43,822,426 (GRCm39) missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43,822,379 (GRCm39) missense probably benign 0.22
R1606:Abcc2 UTSW 19 43,825,091 (GRCm39) missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43,786,858 (GRCm39) missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43,822,426 (GRCm39) missense probably damaging 0.98
R1797:Abcc2 UTSW 19 43,803,225 (GRCm39) missense possibly damaging 0.81
R1826:Abcc2 UTSW 19 43,810,453 (GRCm39) missense probably benign 0.01
R1882:Abcc2 UTSW 19 43,786,945 (GRCm39) missense probably benign 0.00
R1913:Abcc2 UTSW 19 43,795,683 (GRCm39) missense probably benign 0.10
R1986:Abcc2 UTSW 19 43,818,318 (GRCm39) missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43,795,581 (GRCm39) missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43,795,581 (GRCm39) missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43,793,500 (GRCm39) missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43,806,477 (GRCm39) missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43,786,885 (GRCm39) missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43,810,065 (GRCm39) missense probably benign 0.01
R4010:Abcc2 UTSW 19 43,818,303 (GRCm39) missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43,811,559 (GRCm39) missense probably benign
R4064:Abcc2 UTSW 19 43,793,432 (GRCm39) nonsense probably null
R4296:Abcc2 UTSW 19 43,811,514 (GRCm39) missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43,811,513 (GRCm39) missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43,787,575 (GRCm39) missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43,799,558 (GRCm39) missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43,792,178 (GRCm39) missense probably benign 0.07
R4631:Abcc2 UTSW 19 43,803,146 (GRCm39) missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43,789,157 (GRCm39) missense probably benign
R4715:Abcc2 UTSW 19 43,805,321 (GRCm39) missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43,820,553 (GRCm39) missense probably benign 0.23
R4801:Abcc2 UTSW 19 43,807,800 (GRCm39) missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43,807,800 (GRCm39) missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43,789,074 (GRCm39) missense probably benign 0.34
R5143:Abcc2 UTSW 19 43,810,100 (GRCm39) missense probably benign 0.28
R5206:Abcc2 UTSW 19 43,806,589 (GRCm39) missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43,818,339 (GRCm39) missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43,827,904 (GRCm39) utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43,786,633 (GRCm39) missense probably benign 0.22
R5863:Abcc2 UTSW 19 43,786,575 (GRCm39) missense probably benign 0.00
R5928:Abcc2 UTSW 19 43,807,797 (GRCm39) missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43,801,629 (GRCm39) missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43,807,942 (GRCm39) missense probably benign
R6014:Abcc2 UTSW 19 43,815,174 (GRCm39) missense probably benign
R6419:Abcc2 UTSW 19 43,825,947 (GRCm39) splice site probably null
R6497:Abcc2 UTSW 19 43,793,544 (GRCm39) missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43,770,645 (GRCm39) splice site probably null
R6614:Abcc2 UTSW 19 43,807,800 (GRCm39) missense probably benign 0.01
R6649:Abcc2 UTSW 19 43,800,941 (GRCm39) missense probably benign 0.05
R6653:Abcc2 UTSW 19 43,800,941 (GRCm39) missense probably benign 0.05
R6670:Abcc2 UTSW 19 43,827,850 (GRCm39) utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43,786,515 (GRCm39) missense probably benign 0.12
R6989:Abcc2 UTSW 19 43,820,611 (GRCm39) missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43,786,617 (GRCm39) missense probably benign 0.03
R7026:Abcc2 UTSW 19 43,818,974 (GRCm39) missense probably benign 0.01
R7026:Abcc2 UTSW 19 43,805,392 (GRCm39) missense probably benign 0.00
R7136:Abcc2 UTSW 19 43,825,899 (GRCm39) missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43,816,388 (GRCm39) missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43,795,492 (GRCm39) missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43,797,126 (GRCm39) missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43,810,478 (GRCm39) missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43,815,032 (GRCm39) missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43,772,685 (GRCm39) missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43,818,866 (GRCm39) missense probably benign 0.01
R7911:Abcc2 UTSW 19 43,792,109 (GRCm39) missense probably benign 0.00
R7919:Abcc2 UTSW 19 43,805,248 (GRCm39) missense probably damaging 1.00
R7925:Abcc2 UTSW 19 43,795,551 (GRCm39) missense probably benign 0.07
R7993:Abcc2 UTSW 19 43,803,231 (GRCm39) missense possibly damaging 0.71
R8097:Abcc2 UTSW 19 43,805,394 (GRCm39) missense probably benign 0.10
R8177:Abcc2 UTSW 19 43,795,519 (GRCm39) missense probably damaging 1.00
R8492:Abcc2 UTSW 19 43,793,410 (GRCm39) missense probably benign 0.07
R8693:Abcc2 UTSW 19 43,810,474 (GRCm39) missense probably benign 0.06
R8722:Abcc2 UTSW 19 43,825,052 (GRCm39) missense possibly damaging 0.89
R8734:Abcc2 UTSW 19 43,770,855 (GRCm39) missense probably damaging 1.00
R8774:Abcc2 UTSW 19 43,787,577 (GRCm39) missense probably damaging 0.99
R8774-TAIL:Abcc2 UTSW 19 43,787,577 (GRCm39) missense probably damaging 0.99
R8798:Abcc2 UTSW 19 43,797,105 (GRCm39) missense probably benign 0.01
R8889:Abcc2 UTSW 19 43,795,571 (GRCm39) missense possibly damaging 0.88
R8892:Abcc2 UTSW 19 43,795,571 (GRCm39) missense possibly damaging 0.88
R8936:Abcc2 UTSW 19 43,797,101 (GRCm39) missense probably benign 0.35
R9031:Abcc2 UTSW 19 43,810,466 (GRCm39) missense probably benign
R9116:Abcc2 UTSW 19 43,793,391 (GRCm39) missense probably benign 0.30
R9201:Abcc2 UTSW 19 43,786,880 (GRCm39) missense probably damaging 0.97
R9246:Abcc2 UTSW 19 43,786,882 (GRCm39) missense probably benign 0.01
R9345:Abcc2 UTSW 19 43,807,869 (GRCm39) missense probably damaging 0.97
R9487:Abcc2 UTSW 19 43,806,471 (GRCm39) missense probably damaging 1.00
X0025:Abcc2 UTSW 19 43,820,644 (GRCm39) critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43,811,539 (GRCm39) nonsense probably null
Z1177:Abcc2 UTSW 19 43,792,175 (GRCm39) missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43,792,173 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGGCAAGTCAAGACAGTTTG -3'
(R):5'- AGACTTTCCTTTCCAGGCTTGG -3'

Sequencing Primer
(F):5'- TGGGTTGTCAATAAATATAAGAGACC -3'
(R):5'- CAGGCTTGGACACCAGTC -3'
Posted On 2015-11-11