Mutagenetix > Incidental Mutations

Incidental Mutation 'R4760:Abcc2'

356850

Institutional Source

Beutler Lab

Gene Symbol

Abcc2

Ensembl Gene

ENSMUSG00000025194

Gene Name

ATP-binding cassette, sub-family C (CFTR/MRP), member 2

Synonyms

multidrug resistance protein 2, Cmoat, Mrp2

MMRRC Submission

041974-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43782192-43840740 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43810481 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 512 (Y512F)

Ref Sequence

ENSEMBL: ENSMUSP00000026208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026208]

Predicted Effect

probably benign
Transcript: ENSMUST00000026208
AA Change: Y512F

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: Y512F

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC
transmembrane domain	63	85	N/A	INTRINSIC
transmembrane domain	100	116	N/A	INTRINSIC
transmembrane domain	128	150	N/A	INTRINSIC
transmembrane domain	160	182	N/A	INTRINSIC
Pfam:ABC_membrane	319	591	3.4e-37	PFAM
low complexity region	597	608	N/A	INTRINSIC
AAA	661	836	1.77e-8	SMART
low complexity region	906	933	N/A	INTRINSIC
Pfam:ABC_membrane	977	1249	5.4e-48	PFAM
AAA	1324	1509	1.33e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146737

Meta Mutation Damage Score

0.1367

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,721,305	M723K	probably benign	Het
A530053G22Rik	A	G	6: 60,402,101		noncoding transcript	Het
Adgrb1	T	A	15: 74,571,463	I51N	probably damaging	Het
Adhfe1	A	G	1: 9,563,523	Y332C	probably damaging	Het
Ambn	C	T	5: 88,467,707	L317F	probably damaging	Het
Amn1	T	C	6: 149,185,113	Y17C	probably benign	Het
Apoa5	T	C	9: 46,270,295	V223A	probably damaging	Het
BC048403	T	C	10: 121,740,007	V11A	probably damaging	Het
Best3	A	T	10: 117,024,794	H653L	probably benign	Het
Btnl2	C	A	17: 34,363,195	S245Y	probably damaging	Het
Camk1d	A	G	2: 5,362,056	L116P	probably damaging	Het
Catsperg2	T	A	7: 29,705,635	D698V	probably damaging	Het
Cd33	T	C	7: 43,529,495	T307A	probably benign	Het
Cdk8	C	T	5: 146,292,666	S230L	probably benign	Het
Cfap69	C	T	5: 5,646,939	C119Y	probably damaging	Het
Chat	T	C	14: 32,453,737	N122S	probably benign	Het
Col20a1	A	T	2: 180,984,403		probably benign	Het
Cyp2j9	A	T	4: 96,568,791	L481Q	probably damaging	Het
Dab1	A	C	4: 104,732,145	S550R	probably damaging	Het
Dlgap2	A	C	8: 14,773,380	Q533P	probably damaging	Het
Eif4g3	A	T	4: 138,084,318	Q31L	possibly damaging	Het
Ets2	G	A	16: 95,719,043	V438M	probably damaging	Het
Eva1c	G	A	16: 90,904,250	D258N	probably benign	Het
Fastkd2	A	G	1: 63,745,886	H477R	probably benign	Het
Fga	T	G	3: 83,031,514	S399A	probably benign	Het
Fmo4	T	A	1: 162,809,827	E32V	probably damaging	Het
Gm13083	G	A	4: 143,617,231	R367K	probably benign	Het
Gm1840	G	A	8: 5,640,473		noncoding transcript	Het
Gm7204	T	A	16: 48,218,688		noncoding transcript	Het
Hhipl1	A	G	12: 108,320,077	I548V	probably damaging	Het
Hsfy2	T	C	1: 56,637,190	T63A	probably benign	Het
Igf2r	A	G	17: 12,703,465	V1254A	possibly damaging	Het
Ighv8-4	A	T	12: 115,024,047	D110E	probably damaging	Het
Igkv14-130	T	C	6: 67,791,462	S101P	probably benign	Het
Igkv9-120	G	T	6: 68,050,367	R88S	possibly damaging	Het
Ipo5	T	C	14: 120,941,642	V779A	probably benign	Het
Itpr1	C	T	6: 108,349,632	T105I	probably benign	Het
Kalrn	T	C	16: 34,198,487	M670V	probably damaging	Het
Kdm8	T	A	7: 125,455,259		probably null	Het
L3hypdh	T	C	12: 72,077,242	I281V	probably benign	Het
Lins1	T	G	7: 66,714,687		probably benign	Het
Map4k5	T	A	12: 69,824,598	I517L	possibly damaging	Het
March2	G	T	17: 33,709,916	T2K	probably damaging	Het
Mlkl	C	G	8: 111,319,716		probably null	Het
Mllt1	A	G	17: 56,902,630	M160T	probably benign	Het
Mmp15	G	A	8: 95,368,196	A233T	possibly damaging	Het
Moxd2	C	A	6: 40,891,603	T23N	probably benign	Het
Nop53	C	A	7: 15,942,887	K100N	probably benign	Het
Nrg1	C	A	8: 31,918,200	E2*	probably null	Het
Olfr654	T	A	7: 104,588,489	H228Q	probably benign	Het
Pank4	A	G	4: 154,974,634	D408G	possibly damaging	Het
Pcdhb10	T	C	18: 37,411,942	W24R	probably benign	Het
Pcm1	C	T	8: 41,287,738	T968I	probably damaging	Het
Pkib	G	T	10: 57,708,150	M19I	probably benign	Het
Ppy	A	G	11: 102,100,519		probably null	Het
Prdx3	A	C	19: 60,873,183	C39W	possibly damaging	Het
Qrfpr	T	G	3: 36,221,924	N106H	probably benign	Het
Rai14	G	A	15: 10,575,690	T394M	possibly damaging	Het
Ralgapa2	A	T	2: 146,346,749	L1371Q	probably benign	Het
Rbm12	A	G	2: 156,097,128	L408P	probably damaging	Het
Rdx	T	C	9: 52,065,874	I141T	probably benign	Het
Reep1	T	A	6: 71,708,001	V11E	possibly damaging	Het
Sall4	A	G	2: 168,750,427	S936P	probably damaging	Het
Serac1	A	G	17: 6,051,790	M403T	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc35g2	T	G	9: 100,553,496	I41L	probably benign	Het
Slc39a12	G	A	2: 14,400,323	S242N	probably benign	Het
Slc9a2	T	A	1: 40,761,916	D535E	probably damaging	Het
Spata31d1a	G	T	13: 59,701,645	P890T	probably damaging	Het
Sync	A	G	4: 129,293,439	Q88R	probably benign	Het
Tdrp	A	G	8: 13,974,527		probably benign	Het
Tg	G	T	15: 66,693,319	C1170F	probably damaging	Het
Tnks	A	T	8: 34,851,783	D781E	probably benign	Het
Tnp2	T	A	16: 10,788,343	T87S	possibly damaging	Het
Tpp2	T	C	1: 43,971,715	V554A	probably benign	Het
Traf3ip2	T	C	10: 39,645,739	I431T	probably damaging	Het
Trav9d-4	A	T	14: 52,983,801	H84L	probably damaging	Het
Vmn2r42	T	A	7: 8,184,277	Y782F	probably damaging	Het
Vwf	T	C	6: 125,570,604	S231P	probably damaging	Het
Wdr83os	A	G	8: 85,081,867	S83G	probably damaging	Het
Wdr91	T	A	6: 34,908,299	Q109L	probably damaging	Het
Znrf4	A	G	17: 56,511,864	C148R	possibly damaging	Het

Other mutations in Abcc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Abcc2	APN	19	43784202	missense	probably benign	0.39
IGL01611:Abcc2	APN	19	43826629	missense	probably damaging	1.00
IGL01800:Abcc2	APN	19	43784295	missense	possibly damaging	0.78
IGL02008:Abcc2	APN	19	43821750	splice site	probably benign
IGL02041:Abcc2	APN	19	43784235	missense	probably damaging	1.00
IGL02528:Abcc2	APN	19	43798504	missense	probably benign
IGL02950:Abcc2	APN	19	43825967	missense	possibly damaging	0.83
IGL03081:Abcc2	APN	19	43782402	utr 5 prime	probably benign
IGL03397:Abcc2	APN	19	43784304	missense	probably benign	0.00
loser	UTSW	19	43839411	utr 3 prime	probably benign
nelson	UTSW	19	43803739	missense	probably benign	0.07
Sore	UTSW	19	43798194	missense	probably benign	0.22
BB002:Abcc2	UTSW	19	43807112	missense	probably benign	0.07
BB012:Abcc2	UTSW	19	43807112	missense	probably benign	0.07
PIT4453001:Abcc2	UTSW	19	43803782	nonsense	probably null
PIT4519001:Abcc2	UTSW	19	43819397	missense	possibly damaging	0.81
R0197:Abcc2	UTSW	19	43826614	nonsense	probably null
R0326:Abcc2	UTSW	19	43825947	missense	possibly damaging	0.90
R0391:Abcc2	UTSW	19	43821605	splice site	probably benign
R0558:Abcc2	UTSW	19	43800724	missense	probably benign	0.00
R0577:Abcc2	UTSW	19	43819401	missense	probably damaging	1.00
R0787:Abcc2	UTSW	19	43798516	critical splice donor site	probably null
R1189:Abcc2	UTSW	19	43819413	missense	probably damaging	1.00
R1200:Abcc2	UTSW	19	43833987	missense	probably damaging	0.98
R1395:Abcc2	UTSW	19	43833940	missense	probably benign	0.22
R1606:Abcc2	UTSW	19	43836652	missense	probably damaging	1.00
R1775:Abcc2	UTSW	19	43798419	missense	possibly damaging	0.88
R1797:Abcc2	UTSW	19	43814786	missense	possibly damaging	0.81
R1797:Abcc2	UTSW	19	43833987	missense	probably damaging	0.98
R1826:Abcc2	UTSW	19	43822014	missense	probably benign	0.01
R1882:Abcc2	UTSW	19	43798506	missense	probably benign	0.00
R1913:Abcc2	UTSW	19	43807244	missense	probably benign	0.10
R1986:Abcc2	UTSW	19	43829879	missense	probably damaging	1.00
R1991:Abcc2	UTSW	19	43807142	missense	probably damaging	1.00
R1992:Abcc2	UTSW	19	43807142	missense	probably damaging	1.00
R2006:Abcc2	UTSW	19	43805061	missense	probably damaging	1.00
R2057:Abcc2	UTSW	19	43818038	missense	probably damaging	1.00
R3709:Abcc2	UTSW	19	43798446	missense	possibly damaging	0.80
R3802:Abcc2	UTSW	19	43821626	missense	probably benign	0.01
R4010:Abcc2	UTSW	19	43829864	missense	possibly damaging	0.75
R4014:Abcc2	UTSW	19	43823120	missense	probably benign
R4064:Abcc2	UTSW	19	43804993	nonsense	probably null
R4296:Abcc2	UTSW	19	43823074	missense	probably damaging	1.00
R4296:Abcc2	UTSW	19	43823075	missense	probably damaging	1.00
R4363:Abcc2	UTSW	19	43799136	missense	possibly damaging	0.94
R4580:Abcc2	UTSW	19	43811119	missense	probably damaging	1.00
R4625:Abcc2	UTSW	19	43803739	missense	probably benign	0.07
R4631:Abcc2	UTSW	19	43814707	missense	possibly damaging	0.70
R4671:Abcc2	UTSW	19	43800718	missense	probably benign
R4715:Abcc2	UTSW	19	43816882	missense	possibly damaging	0.54
R4726:Abcc2	UTSW	19	43832114	missense	probably benign	0.23
R4801:Abcc2	UTSW	19	43819361	missense	probably damaging	1.00
R4802:Abcc2	UTSW	19	43819361	missense	probably damaging	1.00
R4976:Abcc2	UTSW	19	43800635	missense	probably benign	0.34
R5143:Abcc2	UTSW	19	43821661	missense	probably benign	0.28
R5206:Abcc2	UTSW	19	43818150	missense	probably damaging	1.00
R5376:Abcc2	UTSW	19	43829900	missense	possibly damaging	0.76
R5478:Abcc2	UTSW	19	43839465	utr 3 prime	probably benign
R5700:Abcc2	UTSW	19	43798194	missense	probably benign	0.22
R5863:Abcc2	UTSW	19	43798136	missense	probably benign	0.00
R5928:Abcc2	UTSW	19	43819358	missense	probably damaging	1.00
R5955:Abcc2	UTSW	19	43813190	missense	probably damaging	0.98
R5983:Abcc2	UTSW	19	43819503	missense	probably benign
R6014:Abcc2	UTSW	19	43826735	missense	probably benign
R6419:Abcc2	UTSW	19	43837508	splice site	probably null
R6497:Abcc2	UTSW	19	43805105	missense	probably damaging	1.00
R6510:Abcc2	UTSW	19	43782206	splice site	probably null
R6614:Abcc2	UTSW	19	43819361	missense	probably benign	0.01
R6649:Abcc2	UTSW	19	43812502	missense	probably benign	0.05
R6653:Abcc2	UTSW	19	43812502	missense	probably benign	0.05
R6670:Abcc2	UTSW	19	43839411	utr 3 prime	probably benign
R6964:Abcc2	UTSW	19	43798076	missense	probably benign	0.12
R6989:Abcc2	UTSW	19	43832172	missense	probably damaging	1.00
R7015:Abcc2	UTSW	19	43798178	missense	probably benign	0.03
R7026:Abcc2	UTSW	19	43816953	missense	probably benign	0.00
R7026:Abcc2	UTSW	19	43830535	missense	probably benign	0.01
R7136:Abcc2	UTSW	19	43837460	missense	probably damaging	1.00
R7252:Abcc2	UTSW	19	43827949	missense	probably damaging	0.98
R7293:Abcc2	UTSW	19	43807053	missense	probably damaging	1.00
R7392:Abcc2	UTSW	19	43808687	missense	probably damaging	0.97
R7450:Abcc2	UTSW	19	43822039	missense	probably damaging	1.00
R7654:Abcc2	UTSW	19	43826593	missense	possibly damaging	0.87
R7787:Abcc2	UTSW	19	43784246	missense	probably damaging	1.00
R7815:Abcc2	UTSW	19	43830427	missense	probably benign	0.01
R7911:Abcc2	UTSW	19	43803670	missense	probably benign	0.00
R7919:Abcc2	UTSW	19	43816809	missense	probably damaging	1.00
R7925:Abcc2	UTSW	19	43807112	missense	probably benign	0.07
R7993:Abcc2	UTSW	19	43814792	missense	possibly damaging	0.71
R8097:Abcc2	UTSW	19	43816955	missense	probably benign	0.10
R8177:Abcc2	UTSW	19	43807080	missense	probably damaging	1.00
R8492:Abcc2	UTSW	19	43804971	missense	probably benign	0.07
X0025:Abcc2	UTSW	19	43832205	critical splice donor site	probably null
Z1177:Abcc2	UTSW	19	43803734	missense	probably benign	0.05
Z1177:Abcc2	UTSW	19	43803736	missense	probably benign	0.00
Z1177:Abcc2	UTSW	19	43823100	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGGCAAGTCAAGACAGTTTG -3'
(R):5'- AGACTTTCCTTTCCAGGCTTGG -3'

Sequencing Primer
(F):5'- TGGGTTGTCAATAAATATAAGAGACC -3'
(R):5'- CAGGCTTGGACACCAGTC -3'

Posted On

2015-11-11