Incidental Mutation 'R4761:Lefty1'
ID356860
Institutional Source Beutler Lab
Gene Symbol Lefty1
Ensembl Gene ENSMUSG00000038793
Gene Nameleft right determination factor 1
Synonymslefty-1, Lefty, Stra3, Ebaf
MMRRC Submission 042402-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4761 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180935022-180938400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180937625 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 253 (C253S)
Ref Sequence ENSEMBL: ENSMUSP00000041427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027800] [ENSMUST00000037361] [ENSMUST00000159436] [ENSMUST00000161847] [ENSMUST00000162283]
Predicted Effect probably benign
Transcript: ENSMUST00000027800
SMART Domains Protein: ENSMUSP00000027800
Gene: ENSMUSG00000026519

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 213 3.3e-24 PFAM
Pfam:PHM7_cyt 261 327 8.2e-12 PFAM
Pfam:RSN1_7TM 349 692 1.5e-87 PFAM
transmembrane domain 697 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037361
AA Change: C253S

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041427
Gene: ENSMUSG00000038793
AA Change: C253S

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:TGFb_propeptide 19 237 1.6e-13 PFAM
TGFB 265 356 5.78e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132087
Predicted Effect probably benign
Transcript: ENSMUST00000159436
SMART Domains Protein: ENSMUSP00000125192
Gene: ENSMUSG00000026519

DomainStartEndE-ValueType
Pfam:RSN1_TM 50 173 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161847
SMART Domains Protein: ENSMUSP00000124937
Gene: ENSMUSG00000026519

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162283
Meta Mutation Damage Score 0.3359 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which plays a role in left-right asymmetry determination of organ systems during development. Mice lacking a functional copy of this gene exhibit embryonic lethality and defects in left-right patterning. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic and postnatal lethality, abnormal liver lobation, and a variety of left-right positional defects in visceral organs including left thoracic and atrial isomerism. A subset of mice homozygous for a differentnull allele show left pulmonary isomerism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,067,198 V210D probably damaging Het
4931409K22Rik A G 5: 24,551,983 V232A probably benign Het
9630041A04Rik A G 9: 101,942,966 D195G possibly damaging Het
Abcc8 G A 7: 46,113,075 R1221C probably damaging Het
Adra1a T A 14: 66,727,431 probably null Het
Akr1c6 A T 13: 4,447,011 M98L probably benign Het
Alpk3 A G 7: 81,104,168 Q1632R probably damaging Het
Arhgap24 G T 5: 102,664,214 probably benign Het
Atp8b5 A G 4: 43,308,504 *40W probably null Het
Bdkrb2 A T 12: 105,588,278 M17L probably benign Het
C4bp T C 1: 130,653,421 K117R possibly damaging Het
Cacng3 A T 7: 122,768,664 T256S probably benign Het
Cep63 T C 9: 102,587,041 probably benign Het
Ces2b T A 8: 104,836,561 probably null Het
Col12a1 T A 9: 79,657,310 D1696V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcst1 A T 3: 89,357,553 M296K possibly damaging Het
Diexf T C 1: 193,113,922 Y145C probably damaging Het
Ehbp1l1 G A 19: 5,719,847 P476L possibly damaging Het
Enpp1 A G 10: 24,641,951 V858A possibly damaging Het
Ermp1 T A 19: 29,646,256 E55D probably benign Het
Eya1 G A 1: 14,302,821 L25F probably damaging Het
Foxn2 T A 17: 88,462,708 probably null Het
Gabrb3 A T 7: 57,765,502 T107S probably damaging Het
Gm21964 A T 8: 110,110,121 D213V probably damaging Het
Gm26678 A T 3: 54,633,143 noncoding transcript Het
Gm5415 A T 1: 32,546,507 S107R possibly damaging Het
Gm7897 G T 1: 173,829,970 noncoding transcript Het
Gm9789 A T 16: 89,158,027 Y8F unknown Het
Gsta3 A T 1: 21,260,157 T78S probably benign Het
H2-Ab1 A G 17: 34,267,500 N178D probably damaging Het
Herc6 G A 6: 57,662,900 V1000I probably benign Het
Hrnr A C 3: 93,322,755 K100T probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Kmt2a C A 9: 44,849,124 R509L probably damaging Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Mfsd9 T C 1: 40,774,475 K227E possibly damaging Het
Mrps2 C G 2: 28,469,934 H268D probably benign Het
Mrps27 T A 13: 99,412,231 S292T probably benign Het
Ncaph T C 2: 127,106,116 D683G probably benign Het
Nlrc3 A T 16: 3,963,650 S632T probably damaging Het
Nsun6 T C 2: 15,030,061 T198A possibly damaging Het
Oasl2 C T 5: 114,899,775 H78Y probably benign Het
Olfr921 T C 9: 38,775,837 V194A probably benign Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdgfrb C A 18: 61,079,700 S892Y probably damaging Het
Por T G 5: 135,725,930 probably benign Het
Ppp2r5e A T 12: 75,593,261 V22D possibly damaging Het
Prcp A G 7: 92,917,725 probably null Het
Ptchd3 A T 11: 121,836,398 N366I possibly damaging Het
Rprd1b A G 2: 158,047,970 E4G probably damaging Het
Serpinb6d C A 13: 33,671,267 S308Y probably damaging Het
Slc12a7 T C 13: 73,813,589 V1026A probably benign Het
Slc17a7 G A 7: 45,170,984 V313I probably benign Het
Slc35c1 T A 2: 92,458,823 M113L probably damaging Het
Smgc A G 15: 91,845,514 T178A possibly damaging Het
Spef2 A T 15: 9,652,954 W914R probably damaging Het
Srfbp1 C A 18: 52,488,566 P233Q probably damaging Het
Swt1 A C 1: 151,401,102 C508G probably benign Het
Tex22 T C 12: 113,088,766 V148A possibly damaging Het
Tpd52 G A 3: 8,963,873 P37L probably damaging Het
Vmn1r197 A T 13: 22,328,004 M32L probably benign Het
Vmn2r100 T C 17: 19,521,368 F114S possibly damaging Het
Xdh T A 17: 73,910,267 I669F possibly damaging Het
Zfp940 G A 7: 29,846,153 R110C probably benign Het
Other mutations in Lefty1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02445:Lefty1 APN 1 180937677 missense probably benign 0.01
IGL02974:Lefty1 APN 1 180935277 missense probably benign 0.21
R0230:Lefty1 UTSW 1 180937014 missense probably damaging 1.00
R0383:Lefty1 UTSW 1 180937634 nonsense probably null
R1976:Lefty1 UTSW 1 180937824 missense probably benign 0.01
R2351:Lefty1 UTSW 1 180937242 missense possibly damaging 0.80
R4027:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4028:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4029:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4030:Lefty1 UTSW 1 180937781 missense probably benign 0.00
R4719:Lefty1 UTSW 1 180937712 missense probably benign 0.01
R5476:Lefty1 UTSW 1 180937698 missense probably benign 0.06
R6151:Lefty1 UTSW 1 180935116 missense unknown
R6175:Lefty1 UTSW 1 180935149 missense unknown
R6362:Lefty1 UTSW 1 180937160 missense probably benign 0.39
R7153:Lefty1 UTSW 1 180937767 missense probably benign 0.01
R7678:Lefty1 UTSW 1 180936760 missense probably damaging 0.99
R7765:Lefty1 UTSW 1 180936547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCAGTGGGTTTGAAATC -3'
(R):5'- CTTCACGCTGACAATCATGGG -3'

Sequencing Primer
(F):5'- CAGTGGGTTTGAAATCTAGGCCAG -3'
(R):5'- TCATCTCTGAGGCGACACACTG -3'
Posted On2015-11-11