Incidental Mutation 'R4761:Cep63'
ID356891
Institutional Source Beutler Lab
Gene Symbol Cep63
Ensembl Gene ENSMUSG00000032534
Gene Namecentrosomal protein 63
SynonymsD9Mgc48e, CD20R, D9Mgc41, ET2
MMRRC Submission 042402-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R4761 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location102584588-102626534 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 102587041 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093791] [ENSMUST00000162655] [ENSMUST00000216281]
Predicted Effect probably benign
Transcript: ENSMUST00000093791
SMART Domains Protein: ENSMUSP00000091306
Gene: ENSMUSG00000032534

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:CEP63 76 338 8.1e-112 PFAM
coiled coil region 401 469 N/A INTRINSIC
coiled coil region 492 591 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
coiled coil region 730 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162655
SMART Domains Protein: ENSMUSP00000125621
Gene: ENSMUSG00000032534

DomainStartEndE-ValueType
coiled coil region 72 220 N/A INTRINSIC
coiled coil region 243 283 N/A INTRINSIC
coiled coil region 343 411 N/A INTRINSIC
coiled coil region 434 484 N/A INTRINSIC
coiled coil region 510 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192240
Predicted Effect probably benign
Transcript: ENSMUST00000216281
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene encodes a subunit of the centrosome, the main microtubule-organizing center of the cell. The encoded protein associates with another centrosomal protein, CEP152, to regulate mother-centriole-dependent centriole duplication in dividing cells. Disruption of a similar gene in human has been associated with primary microcephaly (MCPH). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth defects, microcephaly, thin cerebral cortex, mitotic defects and cell death in neural progenitors, decreased oocyte number, small testis, and severely impaired spermatogenesis and meiotic recombination leading to male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,067,198 V210D probably damaging Het
4931409K22Rik A G 5: 24,551,983 V232A probably benign Het
9630041A04Rik A G 9: 101,942,966 D195G possibly damaging Het
Abcc8 G A 7: 46,113,075 R1221C probably damaging Het
Adra1a T A 14: 66,727,431 probably null Het
Akr1c6 A T 13: 4,447,011 M98L probably benign Het
Alpk3 A G 7: 81,104,168 Q1632R probably damaging Het
Arhgap24 G T 5: 102,664,214 probably benign Het
Atp8b5 A G 4: 43,308,504 *40W probably null Het
Bdkrb2 A T 12: 105,588,278 M17L probably benign Het
C4bp T C 1: 130,653,421 K117R possibly damaging Het
Cacng3 A T 7: 122,768,664 T256S probably benign Het
Ces2b T A 8: 104,836,561 probably null Het
Col12a1 T A 9: 79,657,310 D1696V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcst1 A T 3: 89,357,553 M296K possibly damaging Het
Diexf T C 1: 193,113,922 Y145C probably damaging Het
Ehbp1l1 G A 19: 5,719,847 P476L possibly damaging Het
Enpp1 A G 10: 24,641,951 V858A possibly damaging Het
Ermp1 T A 19: 29,646,256 E55D probably benign Het
Eya1 G A 1: 14,302,821 L25F probably damaging Het
Foxn2 T A 17: 88,462,708 probably null Het
Gabrb3 A T 7: 57,765,502 T107S probably damaging Het
Gm21964 A T 8: 110,110,121 D213V probably damaging Het
Gm26678 A T 3: 54,633,143 noncoding transcript Het
Gm5415 A T 1: 32,546,507 S107R possibly damaging Het
Gm7897 G T 1: 173,829,970 noncoding transcript Het
Gm9789 A T 16: 89,158,027 Y8F unknown Het
Gsta3 A T 1: 21,260,157 T78S probably benign Het
H2-Ab1 A G 17: 34,267,500 N178D probably damaging Het
Herc6 G A 6: 57,662,900 V1000I probably benign Het
Hrnr A C 3: 93,322,755 K100T probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Kmt2a C A 9: 44,849,124 R509L probably damaging Het
Lefty1 T A 1: 180,937,625 C253S probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Mfsd9 T C 1: 40,774,475 K227E possibly damaging Het
Mrps2 C G 2: 28,469,934 H268D probably benign Het
Mrps27 T A 13: 99,412,231 S292T probably benign Het
Ncaph T C 2: 127,106,116 D683G probably benign Het
Nlrc3 A T 16: 3,963,650 S632T probably damaging Het
Nsun6 T C 2: 15,030,061 T198A possibly damaging Het
Oasl2 C T 5: 114,899,775 H78Y probably benign Het
Olfr921 T C 9: 38,775,837 V194A probably benign Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdgfrb C A 18: 61,079,700 S892Y probably damaging Het
Por T G 5: 135,725,930 probably benign Het
Ppp2r5e A T 12: 75,593,261 V22D possibly damaging Het
Prcp A G 7: 92,917,725 probably null Het
Ptchd3 A T 11: 121,836,398 N366I possibly damaging Het
Rprd1b A G 2: 158,047,970 E4G probably damaging Het
Serpinb6d C A 13: 33,671,267 S308Y probably damaging Het
Slc12a7 T C 13: 73,813,589 V1026A probably benign Het
Slc17a7 G A 7: 45,170,984 V313I probably benign Het
Slc35c1 T A 2: 92,458,823 M113L probably damaging Het
Smgc A G 15: 91,845,514 T178A possibly damaging Het
Spef2 A T 15: 9,652,954 W914R probably damaging Het
Srfbp1 C A 18: 52,488,566 P233Q probably damaging Het
Swt1 A C 1: 151,401,102 C508G probably benign Het
Tex22 T C 12: 113,088,766 V148A possibly damaging Het
Tpd52 G A 3: 8,963,873 P37L probably damaging Het
Vmn1r197 A T 13: 22,328,004 M32L probably benign Het
Vmn2r100 T C 17: 19,521,368 F114S possibly damaging Het
Xdh T A 17: 73,910,267 I669F possibly damaging Het
Zfp940 G A 7: 29,846,153 R110C probably benign Het
Other mutations in Cep63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Cep63 APN 9 102590458 missense possibly damaging 0.88
IGL02378:Cep63 APN 9 102596115 splice site probably benign
IGL02707:Cep63 APN 9 102586981 missense probably damaging 1.00
IGL03273:Cep63 APN 9 102602467 missense probably benign 0.13
R0355:Cep63 UTSW 9 102623560 missense probably benign
R0847:Cep63 UTSW 9 102588758 missense probably benign 0.12
R1276:Cep63 UTSW 9 102588900 missense possibly damaging 0.77
R1398:Cep63 UTSW 9 102603086 splice site probably benign
R1654:Cep63 UTSW 9 102586913 missense possibly damaging 0.87
R1730:Cep63 UTSW 9 102618867 missense possibly damaging 0.93
R1982:Cep63 UTSW 9 102602880 missense probably damaging 0.99
R2359:Cep63 UTSW 9 102594564 missense possibly damaging 0.95
R2890:Cep63 UTSW 9 102618827 missense probably damaging 0.99
R3082:Cep63 UTSW 9 102602497 missense probably benign 0.00
R4725:Cep63 UTSW 9 102590556 intron probably benign
R5200:Cep63 UTSW 9 102598188 missense probably benign 0.22
R5538:Cep63 UTSW 9 102588793 nonsense probably null
R6463:Cep63 UTSW 9 102596155 missense probably benign
R6887:Cep63 UTSW 9 102625927 intron probably benign
Predicted Primers PCR Primer
(F):5'- TAATCCAGTCTTCCGTCTGTGG -3'
(R):5'- ACACTTTACACAGACACTCTTTGG -3'

Sequencing Primer
(F):5'- CTACACGAGGGCTGTGAACTG -3'
(R):5'- CTCTTTGGGTCAGAAAGAAAGAGCTC -3'
Posted On2015-11-11