Incidental Mutation 'R4761:Vmn2r100'
ID356909
Institutional Source Beutler Lab
Gene Symbol Vmn2r100
Ensembl Gene ENSMUSG00000091859
Gene Namevomeronasal 2, receptor 100
SynonymsEG627537
MMRRC Submission 042402-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4761 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19504732-19535231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19521368 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 114 (F114S)
Ref Sequence ENSEMBL: ENSMUSP00000156263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166081] [ENSMUST00000231465]
Predicted Effect probably benign
Transcript: ENSMUST00000166081
AA Change: F114S

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128350
Gene: ENSMUSG00000091859
AA Change: F114S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 456 7.4e-41 PFAM
Pfam:NCD3G 510 563 1.9e-21 PFAM
Pfam:7tm_3 594 831 2.6e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000231465
AA Change: F114S

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,067,198 V210D probably damaging Het
4931409K22Rik A G 5: 24,551,983 V232A probably benign Het
9630041A04Rik A G 9: 101,942,966 D195G possibly damaging Het
Abcc8 G A 7: 46,113,075 R1221C probably damaging Het
Adra1a T A 14: 66,727,431 probably null Het
Akr1c6 A T 13: 4,447,011 M98L probably benign Het
Alpk3 A G 7: 81,104,168 Q1632R probably damaging Het
Arhgap24 G T 5: 102,664,214 probably benign Het
Atp8b5 A G 4: 43,308,504 *40W probably null Het
Bdkrb2 A T 12: 105,588,278 M17L probably benign Het
C4bp T C 1: 130,653,421 K117R possibly damaging Het
Cacng3 A T 7: 122,768,664 T256S probably benign Het
Cep63 T C 9: 102,587,041 probably benign Het
Ces2b T A 8: 104,836,561 probably null Het
Col12a1 T A 9: 79,657,310 D1696V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcst1 A T 3: 89,357,553 M296K possibly damaging Het
Diexf T C 1: 193,113,922 Y145C probably damaging Het
Ehbp1l1 G A 19: 5,719,847 P476L possibly damaging Het
Enpp1 A G 10: 24,641,951 V858A possibly damaging Het
Ermp1 T A 19: 29,646,256 E55D probably benign Het
Eya1 G A 1: 14,302,821 L25F probably damaging Het
Foxn2 T A 17: 88,462,708 probably null Het
Gabrb3 A T 7: 57,765,502 T107S probably damaging Het
Gm21964 A T 8: 110,110,121 D213V probably damaging Het
Gm26678 A T 3: 54,633,143 noncoding transcript Het
Gm5415 A T 1: 32,546,507 S107R possibly damaging Het
Gm7897 G T 1: 173,829,970 noncoding transcript Het
Gm9789 A T 16: 89,158,027 Y8F unknown Het
Gsta3 A T 1: 21,260,157 T78S probably benign Het
H2-Ab1 A G 17: 34,267,500 N178D probably damaging Het
Herc6 G A 6: 57,662,900 V1000I probably benign Het
Hrnr A C 3: 93,322,755 K100T probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Kmt2a C A 9: 44,849,124 R509L probably damaging Het
Lefty1 T A 1: 180,937,625 C253S probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Mfsd9 T C 1: 40,774,475 K227E possibly damaging Het
Mrps2 C G 2: 28,469,934 H268D probably benign Het
Mrps27 T A 13: 99,412,231 S292T probably benign Het
Ncaph T C 2: 127,106,116 D683G probably benign Het
Nlrc3 A T 16: 3,963,650 S632T probably damaging Het
Nsun6 T C 2: 15,030,061 T198A possibly damaging Het
Oasl2 C T 5: 114,899,775 H78Y probably benign Het
Olfr921 T C 9: 38,775,837 V194A probably benign Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdgfrb C A 18: 61,079,700 S892Y probably damaging Het
Por T G 5: 135,725,930 probably benign Het
Ppp2r5e A T 12: 75,593,261 V22D possibly damaging Het
Prcp A G 7: 92,917,725 probably null Het
Ptchd3 A T 11: 121,836,398 N366I possibly damaging Het
Rprd1b A G 2: 158,047,970 E4G probably damaging Het
Serpinb6d C A 13: 33,671,267 S308Y probably damaging Het
Slc12a7 T C 13: 73,813,589 V1026A probably benign Het
Slc17a7 G A 7: 45,170,984 V313I probably benign Het
Slc35c1 T A 2: 92,458,823 M113L probably damaging Het
Smgc A G 15: 91,845,514 T178A possibly damaging Het
Spef2 A T 15: 9,652,954 W914R probably damaging Het
Srfbp1 C A 18: 52,488,566 P233Q probably damaging Het
Swt1 A C 1: 151,401,102 C508G probably benign Het
Tex22 T C 12: 113,088,766 V148A possibly damaging Het
Tpd52 G A 3: 8,963,873 P37L probably damaging Het
Vmn1r197 A T 13: 22,328,004 M32L probably benign Het
Xdh T A 17: 73,910,267 I669F possibly damaging Het
Zfp940 G A 7: 29,846,153 R110C probably benign Het
Other mutations in Vmn2r100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Vmn2r100 APN 17 19526000 missense probably damaging 1.00
IGL00912:Vmn2r100 APN 17 19531392 missense possibly damaging 0.95
IGL01107:Vmn2r100 APN 17 19521356 missense probably damaging 1.00
IGL01517:Vmn2r100 APN 17 19521963 missense probably benign 0.37
IGL01594:Vmn2r100 APN 17 19531233 missense possibly damaging 0.52
IGL01657:Vmn2r100 APN 17 19525916 missense possibly damaging 0.89
IGL01822:Vmn2r100 APN 17 19504838 missense probably null 0.00
IGL02020:Vmn2r100 APN 17 19504938 missense possibly damaging 0.78
IGL02060:Vmn2r100 APN 17 19521254 missense possibly damaging 0.79
IGL02126:Vmn2r100 APN 17 19521242 splice site probably benign
IGL02142:Vmn2r100 APN 17 19522321 missense probably damaging 1.00
IGL02308:Vmn2r100 APN 17 19521335 missense possibly damaging 0.90
IGL02407:Vmn2r100 APN 17 19521508 missense probably damaging 0.98
IGL02469:Vmn2r100 APN 17 19531285 nonsense probably null
IGL03088:Vmn2r100 APN 17 19522039 missense probably benign 0.27
IGL03181:Vmn2r100 APN 17 19531945 missense probably damaging 1.00
IGL03405:Vmn2r100 APN 17 19531924 missense probably damaging 1.00
H8562:Vmn2r100 UTSW 17 19521490 missense possibly damaging 0.87
R0012:Vmn2r100 UTSW 17 19504874 missense probably benign
R0012:Vmn2r100 UTSW 17 19526034 missense probably damaging 0.99
R0044:Vmn2r100 UTSW 17 19522179 missense possibly damaging 0.46
R0109:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0111:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0112:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0149:Vmn2r100 UTSW 17 19521247 critical splice acceptor site probably null
R0355:Vmn2r100 UTSW 17 19531320 missense probably benign 0.00
R0395:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0396:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0453:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0465:Vmn2r100 UTSW 17 19531530 missense probably damaging 0.98
R0477:Vmn2r100 UTSW 17 19522514 missense probably benign 0.00
R0510:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0512:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0514:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0518:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0521:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0555:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0608:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0959:Vmn2r100 UTSW 17 19523524 missense possibly damaging 0.95
R1114:Vmn2r100 UTSW 17 19531999 missense probably damaging 1.00
R2027:Vmn2r100 UTSW 17 19522072 missense probably benign 0.02
R2049:Vmn2r100 UTSW 17 19522050 missense probably benign 0.00
R2224:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R2226:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R3618:Vmn2r100 UTSW 17 19523430 missense probably benign
R3715:Vmn2r100 UTSW 17 19532010 missense probably damaging 0.99
R4120:Vmn2r100 UTSW 17 19531953 missense probably damaging 1.00
R4152:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4153:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4154:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4200:Vmn2r100 UTSW 17 19522535 missense probably benign 0.29
R4632:Vmn2r100 UTSW 17 19531954 missense probably damaging 1.00
R4720:Vmn2r100 UTSW 17 19522526 missense probably benign 0.02
R4831:Vmn2r100 UTSW 17 19521410 missense probably benign 0.28
R4951:Vmn2r100 UTSW 17 19532038 missense probably benign 0.01
R5211:Vmn2r100 UTSW 17 19525995 missense possibly damaging 0.67
R5553:Vmn2r100 UTSW 17 19504848 missense possibly damaging 0.64
R5657:Vmn2r100 UTSW 17 19504916 missense probably benign 0.31
R5883:Vmn2r100 UTSW 17 19523524 missense probably benign
R5912:Vmn2r100 UTSW 17 19531809 missense probably damaging 0.99
R6141:Vmn2r100 UTSW 17 19522314 missense probably benign 0.07
R6146:Vmn2r100 UTSW 17 19522260 missense probably benign 0.04
R6500:Vmn2r100 UTSW 17 19522093 missense probably damaging 1.00
R6575:Vmn2r100 UTSW 17 19521409 missense probably benign 0.12
R6647:Vmn2r100 UTSW 17 19522523 missense probably benign 0.00
R7038:Vmn2r100 UTSW 17 19505001 missense possibly damaging 0.76
R7052:Vmn2r100 UTSW 17 19531294 missense possibly damaging 0.95
R7170:Vmn2r100 UTSW 17 19531971 missense probably benign 0.00
R7209:Vmn2r100 UTSW 17 19531314 missense not run
R7312:Vmn2r100 UTSW 17 19522034 missense probably benign 0.01
R7734:Vmn2r100 UTSW 17 19522034 missense probably benign 0.01
R7750:Vmn2r100 UTSW 17 19522464 missense probably benign
R8103:Vmn2r100 UTSW 17 19531153 splice site probably null
R8193:Vmn2r100 UTSW 17 19504840 nonsense probably null
R8267:Vmn2r100 UTSW 17 19522490 nonsense probably null
R8290:Vmn2r100 UTSW 17 19531350 missense probably damaging 0.99
X0062:Vmn2r100 UTSW 17 19531390 missense possibly damaging 0.89
Z1176:Vmn2r100 UTSW 17 19521530 missense probably benign 0.00
Z1177:Vmn2r100 UTSW 17 19504989 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGTGGTTCATATCATCATCC -3'
(R):5'- ATCTGGACTGAATTGTATGGGTCTC -3'

Sequencing Primer
(F):5'- GGTTCATATCATCATCCTCTTGTGTG -3'
(R):5'- AGAACTGACTCTTAGTTCCCAC -3'
Posted On2015-11-11