Incidental Mutation 'R4761:Pcsk5'
ID356917
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 042402-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4761 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17837148 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000050272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618] [ENSMUST00000050715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025618
AA Change: D2G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: D2G

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000050715
AA Change: D2G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050272
Gene: ENSMUSG00000024713
AA Change: D2G

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
PDB:1KN6|A 35 116 6e-11 PDB
Pfam:Peptidase_S8 168 456 2.9e-59 PFAM
Pfam:P_proprotein 507 597 1.5e-34 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 884 1.4e-8 SMART
EGF_like 839 870 3.43e1 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,067,198 V210D probably damaging Het
4931409K22Rik A G 5: 24,551,983 V232A probably benign Het
9630041A04Rik A G 9: 101,942,966 D195G possibly damaging Het
Abcc8 G A 7: 46,113,075 R1221C probably damaging Het
Adra1a T A 14: 66,727,431 probably null Het
Akr1c6 A T 13: 4,447,011 M98L probably benign Het
Alpk3 A G 7: 81,104,168 Q1632R probably damaging Het
Arhgap24 G T 5: 102,664,214 probably benign Het
Atp8b5 A G 4: 43,308,504 *40W probably null Het
Bdkrb2 A T 12: 105,588,278 M17L probably benign Het
C4bp T C 1: 130,653,421 K117R possibly damaging Het
Cacng3 A T 7: 122,768,664 T256S probably benign Het
Cep63 T C 9: 102,587,041 probably benign Het
Ces2b T A 8: 104,836,561 probably null Het
Col12a1 T A 9: 79,657,310 D1696V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcst1 A T 3: 89,357,553 M296K possibly damaging Het
Diexf T C 1: 193,113,922 Y145C probably damaging Het
Ehbp1l1 G A 19: 5,719,847 P476L possibly damaging Het
Enpp1 A G 10: 24,641,951 V858A possibly damaging Het
Ermp1 T A 19: 29,646,256 E55D probably benign Het
Eya1 G A 1: 14,302,821 L25F probably damaging Het
Foxn2 T A 17: 88,462,708 probably null Het
Gabrb3 A T 7: 57,765,502 T107S probably damaging Het
Gm21964 A T 8: 110,110,121 D213V probably damaging Het
Gm26678 A T 3: 54,633,143 noncoding transcript Het
Gm5415 A T 1: 32,546,507 S107R possibly damaging Het
Gm7897 G T 1: 173,829,970 noncoding transcript Het
Gm9789 A T 16: 89,158,027 Y8F unknown Het
Gsta3 A T 1: 21,260,157 T78S probably benign Het
H2-Ab1 A G 17: 34,267,500 N178D probably damaging Het
Herc6 G A 6: 57,662,900 V1000I probably benign Het
Hrnr A C 3: 93,322,755 K100T probably damaging Het
Ift57 T C 16: 49,701,900 F2L probably damaging Het
Kmt2a C A 9: 44,849,124 R509L probably damaging Het
Lefty1 T A 1: 180,937,625 C253S probably benign Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Mfsd9 T C 1: 40,774,475 K227E possibly damaging Het
Mrps2 C G 2: 28,469,934 H268D probably benign Het
Mrps27 T A 13: 99,412,231 S292T probably benign Het
Ncaph T C 2: 127,106,116 D683G probably benign Het
Nlrc3 A T 16: 3,963,650 S632T probably damaging Het
Nsun6 T C 2: 15,030,061 T198A possibly damaging Het
Oasl2 C T 5: 114,899,775 H78Y probably benign Het
Olfr921 T C 9: 38,775,837 V194A probably benign Het
Pdgfrb C A 18: 61,079,700 S892Y probably damaging Het
Por T G 5: 135,725,930 probably benign Het
Ppp2r5e A T 12: 75,593,261 V22D possibly damaging Het
Prcp A G 7: 92,917,725 probably null Het
Ptchd3 A T 11: 121,836,398 N366I possibly damaging Het
Rprd1b A G 2: 158,047,970 E4G probably damaging Het
Serpinb6d C A 13: 33,671,267 S308Y probably damaging Het
Slc12a7 T C 13: 73,813,589 V1026A probably benign Het
Slc17a7 G A 7: 45,170,984 V313I probably benign Het
Slc35c1 T A 2: 92,458,823 M113L probably damaging Het
Smgc A G 15: 91,845,514 T178A possibly damaging Het
Spef2 A T 15: 9,652,954 W914R probably damaging Het
Srfbp1 C A 18: 52,488,566 P233Q probably damaging Het
Swt1 A C 1: 151,401,102 C508G probably benign Het
Tex22 T C 12: 113,088,766 V148A possibly damaging Het
Tpd52 G A 3: 8,963,873 P37L probably damaging Het
Vmn1r197 A T 13: 22,328,004 M32L probably benign Het
Vmn2r100 T C 17: 19,521,368 F114S possibly damaging Het
Xdh T A 17: 73,910,267 I669F possibly damaging Het
Zfp940 G A 7: 29,846,153 R110C probably benign Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17642590 missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
R7631:Pcsk5 UTSW 19 17564780 missense probably damaging 1.00
R7654:Pcsk5 UTSW 19 17456804 missense possibly damaging 0.46
R7677:Pcsk5 UTSW 19 17581229 missense possibly damaging 0.59
R7711:Pcsk5 UTSW 19 17439080 missense possibly damaging 0.82
R7903:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R8032:Pcsk5 UTSW 19 17714787 missense probably damaging 0.98
R8064:Pcsk5 UTSW 19 17714861 missense probably damaging 1.00
R8115:Pcsk5 UTSW 19 17510166 critical splice donor site probably null
R8193:Pcsk5 UTSW 19 17586051 missense possibly damaging 0.64
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGACTAGCTTCTGGGTGC -3'
(R):5'- TGGTCTAAGAGCCTGAGAGG -3'

Sequencing Primer
(F):5'- ACGTTGATGAATCCGTACTTGC -3'
(R):5'- CCTGAGAGGGGCTAGCTGTTC -3'
Posted On2015-11-11