Mutagenetix > Incidental Mutations

Incidental Mutation 'R4762:Olfr1285'

356928

Institutional Source

Beutler Lab

Gene Symbol

Olfr1285

Ensembl Gene

ENSMUSG00000062280

Gene Name

olfactory receptor 1285

Synonyms

MOR248-17P, MOR248-25_p, GA_x6K02T2Q125-72459956-72460837

MMRRC Submission

042403-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R4762 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111408376-111409331 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

T to A at 111408880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000184954]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184954
AA Change: *169R

SMART Domains

Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: *169R

Domain	Start	End	E-Value	Type
Pfam:7tm_4	1	264	7.6e-38	PFAM
Pfam:7tm_1	5	251	7.2e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220153

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	T	C	1: 158,969,556		noncoding transcript	Het
2310030G06Rik	T	C	9: 50,740,667	E87G	probably damaging	Het
Aknad1	A	T	3: 108,775,231	H541L	possibly damaging	Het
Asb15	A	G	6: 24,567,237	E519G	possibly damaging	Het
Atad2	T	C	15: 58,108,362	D373G	probably benign	Het
Bbs12	G	A	3: 37,320,380	V326M	probably damaging	Het
Birc6	T	C	17: 74,629,489	I2617T	probably damaging	Het
Brca2	A	G	5: 150,531,116	T115A	probably benign	Het
Casz1	T	C	4: 148,938,981	L495P	probably damaging	Het
Ccdc30	T	A	4: 119,333,588	I481F	probably damaging	Het
Cept1	A	T	3: 106,539,361	Y56*	probably null	Het
Cfap54	A	C	10: 93,061,453		probably null	Het
Cyp2j8	G	T	4: 96,470,649	D344E	probably damaging	Het
Dido1	A	T	2: 180,689,575	W27R	probably damaging	Het
Disp3	A	G	4: 148,272,118	I95T	probably damaging	Het
Engase	G	T	11: 118,487,094	V237F	possibly damaging	Het
Ephb6	G	A	6: 41,618,160	E703K	probably damaging	Het
Fnip1	A	T	11: 54,499,526	T440S	probably benign	Het
Fnip1	T	A	11: 54,466,171	F35L	probably damaging	Het
Fras1	T	A	5: 96,731,618	H2431Q	probably benign	Het
Fzd4	A	T	7: 89,407,716	T324S	probably damaging	Het
Gm10192	C	G	4: 97,183,108	S20T	probably null	Het
Gm14124	T	A	2: 150,267,629	C80S	possibly damaging	Het
Gpr84	A	T	15: 103,308,600	V350E	probably damaging	Het
Gsto2	T	C	19: 47,874,873	Y63H	probably damaging	Het
Gtpbp6	T	C	5: 110,104,320	T449A	probably damaging	Het
Herc2	G	A	7: 56,170,640	V2876I	probably benign	Het
Hnrnpa3	A	G	2: 75,662,007	I152V	possibly damaging	Het
Hpse2	T	C	19: 42,789,071	D552G	possibly damaging	Het
Itfg1	A	G	8: 85,732,441	V460A	possibly damaging	Het
Jhy	G	A	9: 40,911,198	A548V	probably benign	Het
Klhl21	T	A	4: 152,009,811	L290Q	possibly damaging	Het
Knl1	T	C	2: 119,071,936	S1373P	probably benign	Het
Kpna2	A	C	11: 106,990,259	M426R	probably benign	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Lpar1	T	G	4: 58,437,346	H361P	possibly damaging	Het
Macf1	T	C	4: 123,455,444	T2100A	probably benign	Het
Mfsd13b	T	C	7: 120,991,326	F97L	probably damaging	Het
Mmp15	A	G	8: 95,372,330	K595R	probably benign	Het
Mrps25	C	T	6: 92,175,104	G145D	probably damaging	Het
Muc4	T	A	16: 32,753,625		probably benign	Het
Napa	A	T	7: 16,115,271	K245N	probably benign	Het
Olfr1082	A	G	2: 86,594,037	S264P	possibly damaging	Het
Olfr1284	G	A	2: 111,379,737	V246M	probably damaging	Het
Olfr1386	A	T	11: 49,470,285	I45F	probably damaging	Het
Olfr221	T	A	14: 52,035,464	I216F	possibly damaging	Het
Olfr292	A	G	7: 86,695,121	T222A	probably benign	Het
Olfr796	C	A	10: 129,608,174	M102I	probably damaging	Het
Olfr898	A	G	9: 38,349,281	Y60C	probably damaging	Het
Papss2	A	T	19: 32,638,978	T195S	probably benign	Het
Parp4	T	A	14: 56,610,810	H694Q	probably damaging	Het
Patj	C	T	4: 98,405,570	R20*	probably null	Het
Pcdhgb8	T	A	18: 37,762,366	V163E	probably damaging	Het
Pkd2l1	T	A	19: 44,155,621	T338S	probably benign	Het
Ppargc1b	A	T	18: 61,311,257	S278R	possibly damaging	Het
Ppl	T	C	16: 5,088,982	T1150A	probably benign	Het
Ralgds	A	G	2: 28,552,152	D858G	probably damaging	Het
Rassf2	G	A	2: 132,002,863		probably benign	Het
Ring1	T	C	17: 34,021,997		probably benign	Het
Rusc1	A	C	3: 89,091,642	S278A	probably benign	Het
Samd9l	T	C	6: 3,375,623	N546S	probably benign	Het
Sct	A	C	7: 141,279,041		probably benign	Het
Slc22a12	T	G	19: 6,538,444	H348P	probably benign	Het
Slc25a15	A	G	8: 22,383,232	S143P	probably damaging	Het
Slc26a11	C	A	11: 119,356,831		probably benign	Het
Slc6a20b	A	G	9: 123,598,560	M428T	probably damaging	Het
Smim17	G	A	7: 6,429,322	V88M	probably damaging	Het
Smoc1	G	T	12: 81,167,651	W269L	probably damaging	Het
Sox5	C	T	6: 143,861,383		probably null	Het
Sp100	A	G	1: 85,701,458	*483W	probably null	Het
Sptbn5	T	A	2: 120,077,222		noncoding transcript	Het
Sun5	G	A	2: 153,865,363	R132*	probably null	Het
Tedc2	A	G	17: 24,216,380	V345A	probably benign	Het
Tlr6	T	A	5: 64,954,396	R389S	probably benign	Het
Ttc17	G	T	2: 94,371,768	H396Q	probably damaging	Het
Ttn	A	G	2: 76,943,039	S2340P	probably damaging	Het
Vmn1r219	C	T	13: 23,162,829	Q63*	probably null	Het
Vmn1r224	A	G	17: 20,419,640	T160A	possibly damaging	Het
Vmn2r11	T	C	5: 109,047,570	N630S	probably damaging	Het
Zfp747	A	G	7: 127,374,326	V224A	possibly damaging	Het
Zfp804b	T	C	5: 6,772,250	N271S	probably benign	Het

Other mutations in Olfr1285

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01328:Olfr1285	APN	2	111409219	missense	probably damaging	1.00
IGL01819:Olfr1285	APN	2	111408733	missense	probably damaging	0.99
IGL02109:Olfr1285	APN	2	111408493	exon	noncoding transcript
IGL02407:Olfr1285	APN	2	111408578	exon	noncoding transcript
R0054:Olfr1285	UTSW	2	111408795	missense	probably benign	0.00
R1665:Olfr1285	UTSW	2	111408753	missense	probably damaging	1.00
R2339:Olfr1285	UTSW	2	111409189	missense	probably benign	0.36
R3876:Olfr1285	UTSW	2	111408622	missense	possibly damaging	0.57
R4260:Olfr1285	UTSW	2	111408505	exon	noncoding transcript
R4439:Olfr1285	UTSW	2	111409308	exon	noncoding transcript
R4821:Olfr1285	UTSW	2	111409225	exon	noncoding transcript
R5120:Olfr1285	UTSW	2	111409240	exon	noncoding transcript
R5215:Olfr1285	UTSW	2	111409286	exon	noncoding transcript
R5244:Olfr1285	UTSW	2	111408554	exon	noncoding transcript
R5667:Olfr1285	UTSW	2	111408473	exon	noncoding transcript
R5671:Olfr1285	UTSW	2	111408473	exon	noncoding transcript
R5687:Olfr1285	UTSW	2	111408688	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGAGCCAGATCCTCTGTGTG -3'
(R):5'- AGCCATCTTTAGAGTGATGTTGAAC -3'

Sequencing Primer
(F):5'- GCCAGATCCTCTGTGTGCATTTC -3'
(R):5'- GCTAAAATGCCACTGTCAG -3'

Posted On

2015-11-11