Incidental Mutation 'R4762:Knl1'
ID356929
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission 042403-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4762 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119071936 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1373 (S1373P)
Ref Sequence ENSEMBL: ENSMUSP00000028799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380]
Predicted Effect probably benign
Transcript: ENSMUST00000028799
AA Change: S1373P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: S1373P

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028802
AA Change: S1373P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: S1373P

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099542
AA Change: S1373P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: S1373P

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik T C 1: 158,969,556 noncoding transcript Het
2310030G06Rik T C 9: 50,740,667 E87G probably damaging Het
Aknad1 A T 3: 108,775,231 H541L possibly damaging Het
Asb15 A G 6: 24,567,237 E519G possibly damaging Het
Atad2 T C 15: 58,108,362 D373G probably benign Het
Bbs12 G A 3: 37,320,380 V326M probably damaging Het
Birc6 T C 17: 74,629,489 I2617T probably damaging Het
Brca2 A G 5: 150,531,116 T115A probably benign Het
Casz1 T C 4: 148,938,981 L495P probably damaging Het
Ccdc30 T A 4: 119,333,588 I481F probably damaging Het
Cept1 A T 3: 106,539,361 Y56* probably null Het
Cfap54 A C 10: 93,061,453 probably null Het
Cyp2j8 G T 4: 96,470,649 D344E probably damaging Het
Dido1 A T 2: 180,689,575 W27R probably damaging Het
Disp3 A G 4: 148,272,118 I95T probably damaging Het
Engase G T 11: 118,487,094 V237F possibly damaging Het
Ephb6 G A 6: 41,618,160 E703K probably damaging Het
Fnip1 T A 11: 54,466,171 F35L probably damaging Het
Fnip1 A T 11: 54,499,526 T440S probably benign Het
Fras1 T A 5: 96,731,618 H2431Q probably benign Het
Fzd4 A T 7: 89,407,716 T324S probably damaging Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm14124 T A 2: 150,267,629 C80S possibly damaging Het
Gpr84 A T 15: 103,308,600 V350E probably damaging Het
Gsto2 T C 19: 47,874,873 Y63H probably damaging Het
Gtpbp6 T C 5: 110,104,320 T449A probably damaging Het
Herc2 G A 7: 56,170,640 V2876I probably benign Het
Hnrnpa3 A G 2: 75,662,007 I152V possibly damaging Het
Hpse2 T C 19: 42,789,071 D552G possibly damaging Het
Itfg1 A G 8: 85,732,441 V460A possibly damaging Het
Jhy G A 9: 40,911,198 A548V probably benign Het
Klhl21 T A 4: 152,009,811 L290Q possibly damaging Het
Kpna2 A C 11: 106,990,259 M426R probably benign Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Lpar1 T G 4: 58,437,346 H361P possibly damaging Het
Macf1 T C 4: 123,455,444 T2100A probably benign Het
Mfsd13b T C 7: 120,991,326 F97L probably damaging Het
Mmp15 A G 8: 95,372,330 K595R probably benign Het
Mrps25 C T 6: 92,175,104 G145D probably damaging Het
Muc4 T A 16: 32,753,625 probably benign Het
Napa A T 7: 16,115,271 K245N probably benign Het
Olfr1082 A G 2: 86,594,037 S264P possibly damaging Het
Olfr1284 G A 2: 111,379,737 V246M probably damaging Het
Olfr1285 T A 2: 111,408,880 noncoding transcript Het
Olfr1386 A T 11: 49,470,285 I45F probably damaging Het
Olfr221 T A 14: 52,035,464 I216F possibly damaging Het
Olfr292 A G 7: 86,695,121 T222A probably benign Het
Olfr796 C A 10: 129,608,174 M102I probably damaging Het
Olfr898 A G 9: 38,349,281 Y60C probably damaging Het
Papss2 A T 19: 32,638,978 T195S probably benign Het
Parp4 T A 14: 56,610,810 H694Q probably damaging Het
Patj C T 4: 98,405,570 R20* probably null Het
Pcdhgb8 T A 18: 37,762,366 V163E probably damaging Het
Pkd2l1 T A 19: 44,155,621 T338S probably benign Het
Ppargc1b A T 18: 61,311,257 S278R possibly damaging Het
Ppl T C 16: 5,088,982 T1150A probably benign Het
Ralgds A G 2: 28,552,152 D858G probably damaging Het
Rassf2 G A 2: 132,002,863 probably benign Het
Ring1 T C 17: 34,021,997 probably benign Het
Rusc1 A C 3: 89,091,642 S278A probably benign Het
Samd9l T C 6: 3,375,623 N546S probably benign Het
Sct A C 7: 141,279,041 probably benign Het
Slc22a12 T G 19: 6,538,444 H348P probably benign Het
Slc25a15 A G 8: 22,383,232 S143P probably damaging Het
Slc26a11 C A 11: 119,356,831 probably benign Het
Slc6a20b A G 9: 123,598,560 M428T probably damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Smoc1 G T 12: 81,167,651 W269L probably damaging Het
Sox5 C T 6: 143,861,383 probably null Het
Sp100 A G 1: 85,701,458 *483W probably null Het
Sptbn5 T A 2: 120,077,222 noncoding transcript Het
Sun5 G A 2: 153,865,363 R132* probably null Het
Tedc2 A G 17: 24,216,380 V345A probably benign Het
Tlr6 T A 5: 64,954,396 R389S probably benign Het
Ttc17 G T 2: 94,371,768 H396Q probably damaging Het
Ttn A G 2: 76,943,039 S2340P probably damaging Het
Vmn1r219 C T 13: 23,162,829 Q63* probably null Het
Vmn1r224 A G 17: 20,419,640 T160A possibly damaging Het
Vmn2r11 T C 5: 109,047,570 N630S probably damaging Het
Zfp747 A G 7: 127,374,326 V224A possibly damaging Het
Zfp804b T C 5: 6,772,250 N271S probably benign Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
R8423:Knl1 UTSW 2 119070032 missense probably damaging 1.00
R8725:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8727:Knl1 UTSW 2 119069043 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ATGTCGCTGCATCCACATG -3'
(R):5'- CATCTCTATCATTCCTGGAACCTAG -3'

Sequencing Primer
(F):5'- TCCACATGGGAAAATGAGTCC -3'
(R):5'- CAAGTAACTGTTCGGCAG -3'
Posted On2015-11-11