Incidental Mutation 'R4762:Dido1'
ID356934
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Namedeath inducer-obliterator 1
Synonyms6720461J16Rik, DIO-1, Datf1, D130048F08Rik
MMRRC Submission 042403-MU
Accession Numbers

Genbank: NM_175551; MGI: 1344352

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4762 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180657964-180709999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 180689575 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 27 (W27R)
Ref Sequence ENSEMBL: ENSMUSP00000119689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087517] [ENSMUST00000103055] [ENSMUST00000103056] [ENSMUST00000103057] [ENSMUST00000130986]
Predicted Effect probably damaging
Transcript: ENSMUST00000087517
AA Change: W27R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: W27R

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103054
Predicted Effect probably damaging
Transcript: ENSMUST00000103055
AA Change: W27R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099344
Gene: ENSMUSG00000038914
AA Change: W27R

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103056
AA Change: W27R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099345
Gene: ENSMUSG00000038914
AA Change: W27R

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 4.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103057
AA Change: W27R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099346
Gene: ENSMUSG00000038914
AA Change: W27R

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 4.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130986
AA Change: W27R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119689
Gene: ENSMUSG00000038914
AA Change: W27R

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
Meta Mutation Damage Score 0.6114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik T C 1: 158,969,556 noncoding transcript Het
2310030G06Rik T C 9: 50,740,667 E87G probably damaging Het
Aknad1 A T 3: 108,775,231 H541L possibly damaging Het
Asb15 A G 6: 24,567,237 E519G possibly damaging Het
Atad2 T C 15: 58,108,362 D373G probably benign Het
Bbs12 G A 3: 37,320,380 V326M probably damaging Het
Birc6 T C 17: 74,629,489 I2617T probably damaging Het
Brca2 A G 5: 150,531,116 T115A probably benign Het
Casz1 T C 4: 148,938,981 L495P probably damaging Het
Ccdc30 T A 4: 119,333,588 I481F probably damaging Het
Cept1 A T 3: 106,539,361 Y56* probably null Het
Cfap54 A C 10: 93,061,453 probably null Het
Cyp2j8 G T 4: 96,470,649 D344E probably damaging Het
Disp3 A G 4: 148,272,118 I95T probably damaging Het
Engase G T 11: 118,487,094 V237F possibly damaging Het
Ephb6 G A 6: 41,618,160 E703K probably damaging Het
Fnip1 T A 11: 54,466,171 F35L probably damaging Het
Fnip1 A T 11: 54,499,526 T440S probably benign Het
Fras1 T A 5: 96,731,618 H2431Q probably benign Het
Fzd4 A T 7: 89,407,716 T324S probably damaging Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm14124 T A 2: 150,267,629 C80S possibly damaging Het
Gpr84 A T 15: 103,308,600 V350E probably damaging Het
Gsto2 T C 19: 47,874,873 Y63H probably damaging Het
Gtpbp6 T C 5: 110,104,320 T449A probably damaging Het
Herc2 G A 7: 56,170,640 V2876I probably benign Het
Hnrnpa3 A G 2: 75,662,007 I152V possibly damaging Het
Hpse2 T C 19: 42,789,071 D552G possibly damaging Het
Itfg1 A G 8: 85,732,441 V460A possibly damaging Het
Jhy G A 9: 40,911,198 A548V probably benign Het
Klhl21 T A 4: 152,009,811 L290Q possibly damaging Het
Knl1 T C 2: 119,071,936 S1373P probably benign Het
Kpna2 A C 11: 106,990,259 M426R probably benign Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Lpar1 T G 4: 58,437,346 H361P possibly damaging Het
Macf1 T C 4: 123,455,444 T2100A probably benign Het
Mfsd13b T C 7: 120,991,326 F97L probably damaging Het
Mmp15 A G 8: 95,372,330 K595R probably benign Het
Mrps25 C T 6: 92,175,104 G145D probably damaging Het
Muc4 T A 16: 32,753,625 probably benign Het
Napa A T 7: 16,115,271 K245N probably benign Het
Olfr1082 A G 2: 86,594,037 S264P possibly damaging Het
Olfr1284 G A 2: 111,379,737 V246M probably damaging Het
Olfr1285 T A 2: 111,408,880 noncoding transcript Het
Olfr1386 A T 11: 49,470,285 I45F probably damaging Het
Olfr221 T A 14: 52,035,464 I216F possibly damaging Het
Olfr292 A G 7: 86,695,121 T222A probably benign Het
Olfr796 C A 10: 129,608,174 M102I probably damaging Het
Olfr898 A G 9: 38,349,281 Y60C probably damaging Het
Papss2 A T 19: 32,638,978 T195S probably benign Het
Parp4 T A 14: 56,610,810 H694Q probably damaging Het
Patj C T 4: 98,405,570 R20* probably null Het
Pcdhgb8 T A 18: 37,762,366 V163E probably damaging Het
Pkd2l1 T A 19: 44,155,621 T338S probably benign Het
Ppargc1b A T 18: 61,311,257 S278R possibly damaging Het
Ppl T C 16: 5,088,982 T1150A probably benign Het
Ralgds A G 2: 28,552,152 D858G probably damaging Het
Rassf2 G A 2: 132,002,863 probably benign Het
Ring1 T C 17: 34,021,997 probably benign Het
Rusc1 A C 3: 89,091,642 S278A probably benign Het
Samd9l T C 6: 3,375,623 N546S probably benign Het
Sct A C 7: 141,279,041 probably benign Het
Slc22a12 T G 19: 6,538,444 H348P probably benign Het
Slc25a15 A G 8: 22,383,232 S143P probably damaging Het
Slc26a11 C A 11: 119,356,831 probably benign Het
Slc6a20b A G 9: 123,598,560 M428T probably damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Smoc1 G T 12: 81,167,651 W269L probably damaging Het
Sox5 C T 6: 143,861,383 probably null Het
Sp100 A G 1: 85,701,458 *483W probably null Het
Sptbn5 T A 2: 120,077,222 noncoding transcript Het
Sun5 G A 2: 153,865,363 R132* probably null Het
Tedc2 A G 17: 24,216,380 V345A probably benign Het
Tlr6 T A 5: 64,954,396 R389S probably benign Het
Ttc17 G T 2: 94,371,768 H396Q probably damaging Het
Ttn A G 2: 76,943,039 S2340P probably damaging Het
Vmn1r219 C T 13: 23,162,829 Q63* probably null Het
Vmn1r224 A G 17: 20,419,640 T160A possibly damaging Het
Vmn2r11 T C 5: 109,047,570 N630S probably damaging Het
Zfp747 A G 7: 127,374,326 V224A possibly damaging Het
Zfp804b T C 5: 6,772,250 N271S probably benign Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180683989 missense probably benign
IGL00834:Dido1 APN 2 180689526 missense possibly damaging 0.87
IGL01317:Dido1 APN 2 180671757 missense probably benign 0.17
IGL01588:Dido1 APN 2 180688875 missense probably benign 0.00
IGL01834:Dido1 APN 2 180684031 splice site probably benign
IGL02102:Dido1 APN 2 180662247 missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180689335 missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180661923 missense probably benign 0.00
IGL02826:Dido1 APN 2 180683958 missense probably benign
IGL02970:Dido1 APN 2 180689415 missense probably damaging 0.99
IGL03110:Dido1 APN 2 180689342 missense probably damaging 1.00
IGL03116:Dido1 APN 2 180670979 missense probably damaging 1.00
3370:Dido1 UTSW 2 180671542 missense probably benign
A4554:Dido1 UTSW 2 180675371 missense probably damaging 1.00
H8441:Dido1 UTSW 2 180689014 missense probably benign 0.12
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0127:Dido1 UTSW 2 180671824 missense probably benign 0.01
R0620:Dido1 UTSW 2 180659851 missense probably benign 0.26
R0734:Dido1 UTSW 2 180660042 missense probably benign 0.01
R1390:Dido1 UTSW 2 180685124 missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180671470 missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1472:Dido1 UTSW 2 180660720 missense probably benign 0.02
R1538:Dido1 UTSW 2 180684970 missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R2020:Dido1 UTSW 2 180659585 missense unknown
R2025:Dido1 UTSW 2 180689181 nonsense probably null
R2026:Dido1 UTSW 2 180689181 nonsense probably null
R2027:Dido1 UTSW 2 180689181 nonsense probably null
R2089:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2495:Dido1 UTSW 2 180689388 missense probably benign 0.00
R2931:Dido1 UTSW 2 180661653 missense probably damaging 1.00
R3418:Dido1 UTSW 2 180660935 missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180684036 splice site probably benign
R4523:Dido1 UTSW 2 180672292 missense probably damaging 1.00
R4674:Dido1 UTSW 2 180687559 missense probably damaging 0.97
R4729:Dido1 UTSW 2 180687650 missense probably benign 0.00
R4786:Dido1 UTSW 2 180670871 missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180661416 missense probably benign 0.02
R4892:Dido1 UTSW 2 180675029 nonsense probably null
R4979:Dido1 UTSW 2 180660813 missense probably damaging 0.98
R5510:Dido1 UTSW 2 180685173 missense probably benign 0.00
R5586:Dido1 UTSW 2 180659652 nonsense probably null
R5672:Dido1 UTSW 2 180671903 missense probably damaging 0.99
R5863:Dido1 UTSW 2 180661773 missense probably benign 0.02
R5943:Dido1 UTSW 2 180661882 missense probably benign 0.00
R5974:Dido1 UTSW 2 180671497 missense probably benign 0.02
R6123:Dido1 UTSW 2 180683967 missense probably benign 0.07
R6214:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6215:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6248:Dido1 UTSW 2 180660255 missense probably damaging 1.00
R6285:Dido1 UTSW 2 180661147 missense probably benign 0.00
R6349:Dido1 UTSW 2 180660701 missense probably benign 0.03
R6437:Dido1 UTSW 2 180675013 missense probably damaging 1.00
R6477:Dido1 UTSW 2 180660481 missense probably benign 0.00
R6836:Dido1 UTSW 2 180662307 missense probably benign 0.16
R7055:Dido1 UTSW 2 180661209 missense probably benign 0.09
R7289:Dido1 UTSW 2 180659631 missense unknown
R7304:Dido1 UTSW 2 180687493 missense probably damaging 1.00
R7343:Dido1 UTSW 2 180675121 missense possibly damaging 0.49
R7363:Dido1 UTSW 2 180662517 nonsense probably null
R7429:Dido1 UTSW 2 180689526 missense possibly damaging 0.87
R7594:Dido1 UTSW 2 180675112 missense probably benign
R7629:Dido1 UTSW 2 180661473 missense probably benign
R7899:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R7946:Dido1 UTSW 2 180661708 missense possibly damaging 0.81
R7951:Dido1 UTSW 2 180670881 missense probably benign 0.01
R8033:Dido1 UTSW 2 180674842 missense probably damaging 1.00
R8069:Dido1 UTSW 2 180660912 missense probably benign
R8331:Dido1 UTSW 2 180660449 missense probably benign 0.00
R8479:Dido1 UTSW 2 180673229 critical splice donor site probably null
V1024:Dido1 UTSW 2 180689014 missense probably benign 0.12
X0011:Dido1 UTSW 2 180660834 missense probably benign 0.00
X0019:Dido1 UTSW 2 180671572 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GATGTGGGCTCACTGGAATC -3'
(R):5'- TGCTCCTGTCAGAAACCCTATC -3'

Sequencing Primer
(F):5'- GGGACACCGGCACATTCTTTTTC -3'
(R):5'- AGAAACCCTATCTTACCACCCTTTG -3'
Posted On2015-11-11