Mutagenetix > Incidental Mutations

Incidental Mutation 'R0403:Itpkc'

35694

Institutional Source

Beutler Lab

Gene Symbol

Itpkc

Ensembl Gene

ENSMUSG00000003752

Gene Name

inositol 1,4,5-trisphosphate 3-kinase C

Synonyms

MMRRC Submission

038608-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.468) question?

Stock #

R0403 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27207172-27228661 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27208345 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 645 (M645L)

Ref Sequence

ENSEMBL: ENSMUSP00000003850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003850] [ENSMUST00000108379] [ENSMUST00000179391]

Predicted Effect

probably benign
Transcript: ENSMUST00000003850
AA Change: M645L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752
AA Change: M645L

Domain	Start	End	E-Value	Type
low complexity region	28	59	N/A	INTRINSIC
low complexity region	346	363	N/A	INTRINSIC
Pfam:IPK	462	673	3.7e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108379

SMART Domains

Protein: ENSMUSP00000104016
Gene: ENSMUSG00000078786

Domain	Start	End	E-Value	Type
low complexity region	26	42	N/A	INTRINSIC
low complexity region	50	80	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000116883

Predicted Effect

probably benign
Transcript: ENSMUST00000123108

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147170

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149067

Predicted Effect

probably benign
Transcript: ENSMUST00000155931

SMART Domains

Protein: ENSMUSP00000123290
Gene: ENSMUSG00000078786

Domain	Start	End	E-Value	Type
low complexity region	14	44	N/A	INTRINSIC
low complexity region	253	264	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179391

SMART Domains

Protein: ENSMUSP00000137189
Gene: ENSMUSG00000078786

Domain	Start	End	E-Value	Type
low complexity region	26	42	N/A	INTRINSIC
low complexity region	50	80	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.0%
3x: 96.8%
10x: 93.2%
20x: 83.7%

Validation Efficiency

97% (110/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. Single nucleotide polymorphisms in this gene are associated with Kawasaki disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: No overt phenotype reported. Thymocyte development was normal in homozygous null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	A	G	11: 105,973,880		probably null	Het
Adgrg3	C	T	8: 95,036,922	L284F	probably benign	Het
Alkbh8	T	A	9: 3,385,469	V587E	probably damaging	Het
Ap4b1	T	A	3: 103,818,839	C244S	probably damaging	Het
Ap4b1	T	A	3: 103,821,396	M590K	probably benign	Het
Arhgap15	C	T	2: 44,063,766	T168I	probably damaging	Het
Arntl2	T	A	6: 146,822,655	H348Q	probably damaging	Het
Atp8b1	A	G	18: 64,540,310	V997A	probably damaging	Het
Atrn	G	A	2: 130,906,859	C100Y	probably damaging	Het
Baiap2l2	C	A	15: 79,271,216	A151S	probably benign	Het
Baz2b	A	T	2: 59,969,377	D199E	possibly damaging	Het
Cblb	A	G	16: 52,152,626	D440G	probably benign	Het
Cdon	T	C	9: 35,473,500	V694A	probably benign	Het
Cep250	A	T	2: 155,992,349	R2065W	probably damaging	Het
Ces2b	G	T	8: 104,833,945	A131S	probably damaging	Het
Chrna9	A	T	5: 65,967,892	T59S	possibly damaging	Het
Cog3	T	A	14: 75,742,327		probably benign	Het
Cpa1	G	A	6: 30,641,857	V227I	probably benign	Het
Cyp3a25	A	T	5: 145,998,513	C98S	probably damaging	Het
D8Ertd738e	C	T	8: 84,249,601		probably null	Het
Ddx60	A	G	8: 61,994,541		probably benign	Het
Dhx16	T	C	17: 35,883,050		probably null	Het
Dnah9	T	A	11: 66,084,789	Q1478L	possibly damaging	Het
Dock10	T	C	1: 80,524,070	Y1434C	possibly damaging	Het
Enpp3	T	A	10: 24,804,436	D325V	probably damaging	Het
Entpd6	C	A	2: 150,760,170	T194K	possibly damaging	Het
Fam208b	A	T	13: 3,582,052	Y816*	probably null	Het
Fat2	A	T	11: 55,270,349	V3185E	probably benign	Het
Flrt1	A	G	19: 7,095,919	L421P	probably benign	Het
Fmn2	A	T	1: 174,694,278	Q1292L	probably damaging	Het
Fndc1	T	C	17: 7,775,588		probably null	Het
Fndc1	T	C	17: 7,753,723	D1459G	probably damaging	Het
Fzr1	A	G	10: 81,369,368	S265P	possibly damaging	Het
Gm13119	A	G	4: 144,362,646	N178S	probably benign	Het
Gm14085	T	C	2: 122,521,854	L364S	probably damaging	Het
Gpr142	G	A	11: 114,806,029	V134M	probably damaging	Het
Grid2ip	G	T	5: 143,357,620	V24L	possibly damaging	Het
Herc2	G	A	7: 56,159,417	R2555H	probably damaging	Het
Hpdl	A	T	4: 116,820,479	Y262N	possibly damaging	Het
Htr3a	A	G	9: 48,908,659	V57A	probably damaging	Het
Igfbp7	T	C	5: 77,355,591	I186V	probably benign	Het
Itga2b	C	T	11: 102,467,326		probably null	Het
Itgae	A	C	11: 73,123,183	D736A	possibly damaging	Het
Jchain	T	C	5: 88,521,378	R139G	probably benign	Het
Kif13a	A	G	13: 46,791,401	V908A	probably damaging	Het
Kif1b	T	A	4: 149,181,967	K389*	probably null	Het
Klhl12	T	C	1: 134,485,856	Y360H	possibly damaging	Het
Knop1	G	A	7: 118,853,053	R148W	probably damaging	Het
Lpar1	T	A	4: 58,487,191	N27Y	probably damaging	Het
Lpar2	T	A	8: 69,824,152	V197D	probably damaging	Het
Lrrc74a	A	G	12: 86,740,979	N128S	probably damaging	Het
Lum	G	T	10: 97,572,043	V337F	probably benign	Het
Mag	T	C	7: 30,906,980	D344G	probably damaging	Het
Maip1	G	A	1: 57,407,196	A142T	probably benign	Het
Mlh3	A	G	12: 85,268,968	V148A	possibly damaging	Het
Nav3	A	G	10: 109,767,103	V1195A	probably damaging	Het
Ncor2	A	G	5: 125,033,337	S868P	possibly damaging	Het
Nek1	A	G	8: 61,106,855	E907G	probably damaging	Het
Nfam1	G	A	15: 83,016,379	T134I	probably benign	Het
Nr0b2	T	C	4: 133,553,759	V112A	probably damaging	Het
Nrp1	A	G	8: 128,457,969	N365S	probably damaging	Het
Nrsn2	T	C	2: 152,369,790	Y107C	probably damaging	Het
Ntng1	G	A	3: 109,934,611	A282V	probably damaging	Het
Nxf1	T	C	19: 8,765,028	I337T	probably damaging	Het
Obscn	C	T	11: 59,076,540	G479D	probably damaging	Het
Olfr45	T	C	7: 140,691,309	S135P	possibly damaging	Het
Oprd1	T	A	4: 132,113,768	D293V	probably benign	Het
P3h2	T	G	16: 25,969,950	N586H	possibly damaging	Het
Pcid2	T	C	8: 13,085,367	Y214C	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Ppic	C	A	18: 53,411,071	G81W	probably damaging	Het
Ppp2r1a	C	A	17: 20,957,041	P246T	probably damaging	Het
Ppp4r4	T	G	12: 103,584,102	S46A	probably benign	Het
Prkce	A	G	17: 86,168,653	T21A	probably damaging	Het
Prkg2	T	C	5: 98,994,645	E210G	possibly damaging	Het
Prss35	A	G	9: 86,756,037	M287V	probably damaging	Het
Psd	G	A	19: 46,320,972		probably benign	Het
Ptch2	A	T	4: 117,110,839	K843*	probably null	Het
Rab44	C	A	17: 29,145,261	T603K	probably damaging	Het
Rasal3	T	A	17: 32,392,790		probably null	Het
Rbbp6	A	G	7: 122,992,296	T526A	probably damaging	Het
Ros1	A	T	10: 52,143,438		probably benign	Het
Sec24b	T	A	3: 129,989,676	L1104F	possibly damaging	Het
Sec24b	A	G	3: 129,999,534	S685P	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Setmar	A	T	6: 108,075,962	H139L	probably benign	Het
Slc4a7	T	C	14: 14,766,808	V710A	probably benign	Het
Smarcc1	T	A	9: 110,237,808		probably null	Het
Smchd1	G	A	17: 71,394,902	L1032F	probably damaging	Het
Speg	T	C	1: 75,430,784		probably benign	Het
Tcea1	C	G	1: 4,889,503	R134G	probably benign	Het
Tchhl1	C	T	3: 93,471,029	Q347*	probably null	Het
Tecrl	A	T	5: 83,354,758		probably benign	Het
Tepsin	T	C	11: 120,093,682		probably benign	Het
Tmem40	G	A	6: 115,733,985		probably benign	Het
Tpr	G	A	1: 150,407,414		probably benign	Het
Ttll12	A	T	15: 83,580,658		probably benign	Het
Ttn	T	A	2: 76,909,608	D3529V	probably benign	Het
Usp34	T	A	11: 23,333,838	H177Q	possibly damaging	Het
Vsig10	T	A	5: 117,338,461	S327T	probably benign	Het
Zbtb4	T	A	11: 69,777,639	M396K	probably damaging	Het
Zfp352	C	T	4: 90,225,009	T462I	possibly damaging	Het
Zfp385b	T	C	2: 77,476,845	M145V	probably damaging	Het
Zfp780b	C	A	7: 27,971,689	V65F	possibly damaging	Het

Other mutations in Itpkc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01751:Itpkc	APN	7	27213066	unclassified	probably benign
IGL01774:Itpkc	APN	7	27212370	missense	probably benign	0.05
IGL02134:Itpkc	APN	7	27227875	nonsense	probably null
IGL02719:Itpkc	APN	7	27228050	missense	possibly damaging	0.92
R0284:Itpkc	UTSW	7	27214543	nonsense	probably null
R0364:Itpkc	UTSW	7	27227749	missense	possibly damaging	0.80
R1175:Itpkc	UTSW	7	27227770	missense	probably benign	0.00
R1676:Itpkc	UTSW	7	27208281	missense	probably damaging	1.00
R1813:Itpkc	UTSW	7	27208380	missense	probably damaging	1.00
R1896:Itpkc	UTSW	7	27208380	missense	probably damaging	1.00
R1944:Itpkc	UTSW	7	27227659	missense	possibly damaging	0.55
R2142:Itpkc	UTSW	7	27219650	missense	possibly damaging	0.83
R3030:Itpkc	UTSW	7	27212308	splice site	probably null
R3738:Itpkc	UTSW	7	27227604	missense	possibly damaging	0.95
R3739:Itpkc	UTSW	7	27227604	missense	possibly damaging	0.95
R3754:Itpkc	UTSW	7	27228432	missense	probably damaging	1.00
R3851:Itpkc	UTSW	7	27227612	missense	probably benign	0.00
R3852:Itpkc	UTSW	7	27227612	missense	probably benign	0.00
R3916:Itpkc	UTSW	7	27228303	missense	probably benign	0.09
R3963:Itpkc	UTSW	7	27227509	missense	probably damaging	1.00
R5770:Itpkc	UTSW	7	27212988	missense	probably damaging	1.00
R5943:Itpkc	UTSW	7	27212979	missense	possibly damaging	0.69
R6012:Itpkc	UTSW	7	27228065	missense	probably damaging	0.98
R6835:Itpkc	UTSW	7	27227815	missense	probably benign	0.02
R7107:Itpkc	UTSW	7	27228277	missense	probably benign	0.15
R7379:Itpkc	UTSW	7	27227769	missense	probably benign	0.12
Z1176:Itpkc	UTSW	7	27227638	missense	probably benign	0.01
Z1177:Itpkc	UTSW	7	27227781	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CAGACACATGCTATCCTGCAAGTGAG -3'
(R):5'- TAGGTTATCGGAGTCTCTGGGCCATC -3'

Sequencing Primer
(F):5'- TATCCTGCAAGTGAGCCTAGC -3'
(R):5'- agtttctgctgtcttaccacc -3'

Posted On

2013-05-09