Incidental Mutation 'R4762:Tlr6'
ID356948
Institutional Source Beutler Lab
Gene Symbol Tlr6
Ensembl Gene ENSMUSG00000051498
Gene Nametoll-like receptor 6
Synonyms
MMRRC Submission 042403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4762 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location64952031-64960097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64954396 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 389 (R389S)
Ref Sequence ENSEMBL: ENSMUSP00000062096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062315] [ENSMUST00000201307]
Predicted Effect probably benign
Transcript: ENSMUST00000062315
AA Change: R389S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000062096
Gene: ENSMUSG00000051498
AA Change: R389S

DomainStartEndE-ValueType
LRR_TYP 86 109 7.67e-2 SMART
LRR 131 155 2.76e1 SMART
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201307
SMART Domains Protein: ENSMUSP00000143865
Gene: ENSMUSG00000051498

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 3.3e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik T C 1: 158,969,556 noncoding transcript Het
2310030G06Rik T C 9: 50,740,667 E87G probably damaging Het
Aknad1 A T 3: 108,775,231 H541L possibly damaging Het
Asb15 A G 6: 24,567,237 E519G possibly damaging Het
Atad2 T C 15: 58,108,362 D373G probably benign Het
Bbs12 G A 3: 37,320,380 V326M probably damaging Het
Birc6 T C 17: 74,629,489 I2617T probably damaging Het
Brca2 A G 5: 150,531,116 T115A probably benign Het
Casz1 T C 4: 148,938,981 L495P probably damaging Het
Ccdc30 T A 4: 119,333,588 I481F probably damaging Het
Cept1 A T 3: 106,539,361 Y56* probably null Het
Cfap54 A C 10: 93,061,453 probably null Het
Cyp2j8 G T 4: 96,470,649 D344E probably damaging Het
Dido1 A T 2: 180,689,575 W27R probably damaging Het
Disp3 A G 4: 148,272,118 I95T probably damaging Het
Engase G T 11: 118,487,094 V237F possibly damaging Het
Ephb6 G A 6: 41,618,160 E703K probably damaging Het
Fnip1 T A 11: 54,466,171 F35L probably damaging Het
Fnip1 A T 11: 54,499,526 T440S probably benign Het
Fras1 T A 5: 96,731,618 H2431Q probably benign Het
Fzd4 A T 7: 89,407,716 T324S probably damaging Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm14124 T A 2: 150,267,629 C80S possibly damaging Het
Gpr84 A T 15: 103,308,600 V350E probably damaging Het
Gsto2 T C 19: 47,874,873 Y63H probably damaging Het
Gtpbp6 T C 5: 110,104,320 T449A probably damaging Het
Herc2 G A 7: 56,170,640 V2876I probably benign Het
Hnrnpa3 A G 2: 75,662,007 I152V possibly damaging Het
Hpse2 T C 19: 42,789,071 D552G possibly damaging Het
Itfg1 A G 8: 85,732,441 V460A possibly damaging Het
Jhy G A 9: 40,911,198 A548V probably benign Het
Klhl21 T A 4: 152,009,811 L290Q possibly damaging Het
Knl1 T C 2: 119,071,936 S1373P probably benign Het
Kpna2 A C 11: 106,990,259 M426R probably benign Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Lpar1 T G 4: 58,437,346 H361P possibly damaging Het
Macf1 T C 4: 123,455,444 T2100A probably benign Het
Mfsd13b T C 7: 120,991,326 F97L probably damaging Het
Mmp15 A G 8: 95,372,330 K595R probably benign Het
Mrps25 C T 6: 92,175,104 G145D probably damaging Het
Muc4 T A 16: 32,753,625 probably benign Het
Napa A T 7: 16,115,271 K245N probably benign Het
Olfr1082 A G 2: 86,594,037 S264P possibly damaging Het
Olfr1284 G A 2: 111,379,737 V246M probably damaging Het
Olfr1285 T A 2: 111,408,880 noncoding transcript Het
Olfr1386 A T 11: 49,470,285 I45F probably damaging Het
Olfr221 T A 14: 52,035,464 I216F possibly damaging Het
Olfr292 A G 7: 86,695,121 T222A probably benign Het
Olfr796 C A 10: 129,608,174 M102I probably damaging Het
Olfr898 A G 9: 38,349,281 Y60C probably damaging Het
Papss2 A T 19: 32,638,978 T195S probably benign Het
Parp4 T A 14: 56,610,810 H694Q probably damaging Het
Patj C T 4: 98,405,570 R20* probably null Het
Pcdhgb8 T A 18: 37,762,366 V163E probably damaging Het
Pkd2l1 T A 19: 44,155,621 T338S probably benign Het
Ppargc1b A T 18: 61,311,257 S278R possibly damaging Het
Ppl T C 16: 5,088,982 T1150A probably benign Het
Ralgds A G 2: 28,552,152 D858G probably damaging Het
Rassf2 G A 2: 132,002,863 probably benign Het
Ring1 T C 17: 34,021,997 probably benign Het
Rusc1 A C 3: 89,091,642 S278A probably benign Het
Samd9l T C 6: 3,375,623 N546S probably benign Het
Sct A C 7: 141,279,041 probably benign Het
Slc22a12 T G 19: 6,538,444 H348P probably benign Het
Slc25a15 A G 8: 22,383,232 S143P probably damaging Het
Slc26a11 C A 11: 119,356,831 probably benign Het
Slc6a20b A G 9: 123,598,560 M428T probably damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Smoc1 G T 12: 81,167,651 W269L probably damaging Het
Sox5 C T 6: 143,861,383 probably null Het
Sp100 A G 1: 85,701,458 *483W probably null Het
Sptbn5 T A 2: 120,077,222 noncoding transcript Het
Sun5 G A 2: 153,865,363 R132* probably null Het
Tedc2 A G 17: 24,216,380 V345A probably benign Het
Ttc17 G T 2: 94,371,768 H396Q probably damaging Het
Ttn A G 2: 76,943,039 S2340P probably damaging Het
Vmn1r219 C T 13: 23,162,829 Q63* probably null Het
Vmn1r224 A G 17: 20,419,640 T160A possibly damaging Het
Vmn2r11 T C 5: 109,047,570 N630S probably damaging Het
Zfp747 A G 7: 127,374,326 V224A possibly damaging Het
Zfp804b T C 5: 6,772,250 N271S probably benign Het
Other mutations in Tlr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
Counterintuitive UTSW 5 64953595 missense probably damaging 1.00
insouciant UTSW 5 64954583 missense possibly damaging 0.81
m2sd1 UTSW 5 64954194 nonsense
m2sd2 UTSW 5 64954394 nonsense
m2sd3 UTSW 5 64954241 missense probably damaging 0.98
One_off UTSW 5 64953251 missense probably damaging 1.00
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
R6711:Tlr6 UTSW 5 64954492 missense probably damaging 1.00
R7096:Tlr6 UTSW 5 64953776 missense probably benign
R7341:Tlr6 UTSW 5 64953629 missense probably benign 0.32
R7594:Tlr6 UTSW 5 64953251 missense probably damaging 1.00
R7754:Tlr6 UTSW 5 64954350 missense possibly damaging 0.64
R7774:Tlr6 UTSW 5 64953385 missense probably damaging 0.99
Z1177:Tlr6 UTSW 5 64955239 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTTGGGAGGTAAGCATCTG -3'
(R):5'- TTTTCAAAGGAGGCGCTATACTC -3'

Sequencing Primer
(F):5'- ACAGAGCCTGTAAGCATATTCG -3'
(R):5'- CGGTGTTTGCTGAGATGAACATCAAG -3'
Posted On2015-11-11