Incidental Mutation 'R4762:Mmp15'
ID 356967
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Name matrix metallopeptidase 15
Synonyms MT2-MMP, Membrane type 2-MMP
MMRRC Submission 042403-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4762 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 96078924-96100921 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96098958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 595 (K595R)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
AlphaFold O54732
Predicted Effect probably benign
Transcript: ENSMUST00000034243
AA Change: K595R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: K595R

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212235
Meta Mutation Damage Score 0.0853 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik T C 1: 158,797,126 (GRCm39) noncoding transcript Het
2310030G06Rik T C 9: 50,651,967 (GRCm39) E87G probably damaging Het
Aknad1 A T 3: 108,682,547 (GRCm39) H541L possibly damaging Het
Asb15 A G 6: 24,567,236 (GRCm39) E519G possibly damaging Het
Atad2 T C 15: 57,971,758 (GRCm39) D373G probably benign Het
Bbs12 G A 3: 37,374,529 (GRCm39) V326M probably damaging Het
Birc6 T C 17: 74,936,484 (GRCm39) I2617T probably damaging Het
Brca2 A G 5: 150,454,581 (GRCm39) T115A probably benign Het
Casz1 T C 4: 149,023,438 (GRCm39) L495P probably damaging Het
Ccdc30 T A 4: 119,190,785 (GRCm39) I481F probably damaging Het
Cept1 A T 3: 106,446,677 (GRCm39) Y56* probably null Het
Cfap54 A C 10: 92,897,315 (GRCm39) probably null Het
Cyp2j8 G T 4: 96,358,886 (GRCm39) D344E probably damaging Het
Dido1 A T 2: 180,331,368 (GRCm39) W27R probably damaging Het
Disp3 A G 4: 148,356,575 (GRCm39) I95T probably damaging Het
Engase G T 11: 118,377,920 (GRCm39) V237F possibly damaging Het
Ephb6 G A 6: 41,595,094 (GRCm39) E703K probably damaging Het
Fnip1 T A 11: 54,356,997 (GRCm39) F35L probably damaging Het
Fnip1 A T 11: 54,390,352 (GRCm39) T440S probably benign Het
Fras1 T A 5: 96,879,477 (GRCm39) H2431Q probably benign Het
Fzd4 A T 7: 89,056,924 (GRCm39) T324S probably damaging Het
Gm10192 C G 4: 97,071,345 (GRCm39) S20T probably null Het
Gpr84 A T 15: 103,217,027 (GRCm39) V350E probably damaging Het
Gsto2 T C 19: 47,863,312 (GRCm39) Y63H probably damaging Het
Gtpbp6 T C 5: 110,252,186 (GRCm39) T449A probably damaging Het
Herc2 G A 7: 55,820,388 (GRCm39) V2876I probably benign Het
Hnrnpa3 A G 2: 75,492,351 (GRCm39) I152V possibly damaging Het
Hpse2 T C 19: 42,777,510 (GRCm39) D552G possibly damaging Het
Itfg1 A G 8: 86,459,070 (GRCm39) V460A possibly damaging Het
Jhy G A 9: 40,822,494 (GRCm39) A548V probably benign Het
Klhl21 T A 4: 152,094,268 (GRCm39) L290Q possibly damaging Het
Knl1 T C 2: 118,902,417 (GRCm39) S1373P probably benign Het
Kpna2 A C 11: 106,881,085 (GRCm39) M426R probably benign Het
Krt9 C T 11: 100,081,675 (GRCm39) V285I probably damaging Het
Lpar1 T G 4: 58,437,346 (GRCm39) H361P possibly damaging Het
Macf1 T C 4: 123,349,237 (GRCm39) T2100A probably benign Het
Mfsd13b T C 7: 120,590,549 (GRCm39) F97L probably damaging Het
Mrps25 C T 6: 92,152,085 (GRCm39) G145D probably damaging Het
Muc4 T A 16: 32,574,916 (GRCm39) probably benign Het
Napa A T 7: 15,849,196 (GRCm39) K245N probably benign Het
Or10p1 C A 10: 129,444,043 (GRCm39) M102I probably damaging Het
Or14c39 A G 7: 86,344,329 (GRCm39) T222A probably benign Het
Or2y1c A T 11: 49,361,112 (GRCm39) I45F probably damaging Het
Or4g17 G A 2: 111,210,082 (GRCm39) V246M probably damaging Het
Or4k39 T A 2: 111,239,225 (GRCm39) noncoding transcript Het
Or5au1 T A 14: 52,272,921 (GRCm39) I216F possibly damaging Het
Or8c20 A G 9: 38,260,577 (GRCm39) Y60C probably damaging Het
Or8k35 A G 2: 86,424,381 (GRCm39) S264P possibly damaging Het
Papss2 A T 19: 32,616,378 (GRCm39) T195S probably benign Het
Parp4 T A 14: 56,848,267 (GRCm39) H694Q probably damaging Het
Patj C T 4: 98,293,807 (GRCm39) R20* probably null Het
Pcdhgb8 T A 18: 37,895,419 (GRCm39) V163E probably damaging Het
Pkd2l1 T A 19: 44,144,060 (GRCm39) T338S probably benign Het
Ppargc1b A T 18: 61,444,328 (GRCm39) S278R possibly damaging Het
Ppl T C 16: 4,906,846 (GRCm39) T1150A probably benign Het
Ralgds A G 2: 28,442,164 (GRCm39) D858G probably damaging Het
Rassf2 G A 2: 131,844,783 (GRCm39) probably benign Het
Ring1 T C 17: 34,240,971 (GRCm39) probably benign Het
Rusc1 A C 3: 88,998,949 (GRCm39) S278A probably benign Het
Samd9l T C 6: 3,375,623 (GRCm39) N546S probably benign Het
Sct A C 7: 140,858,954 (GRCm39) probably benign Het
Slc22a12 T G 19: 6,588,474 (GRCm39) H348P probably benign Het
Slc25a15 A G 8: 22,873,248 (GRCm39) S143P probably damaging Het
Slc26a11 C A 11: 119,247,657 (GRCm39) probably benign Het
Slc6a20b A G 9: 123,427,625 (GRCm39) M428T probably damaging Het
Smim17 G A 7: 6,432,321 (GRCm39) V88M probably damaging Het
Smoc1 G T 12: 81,214,425 (GRCm39) W269L probably damaging Het
Sox5 C T 6: 143,807,109 (GRCm39) probably null Het
Sp100 A G 1: 85,629,179 (GRCm39) *483W probably null Het
Sptbn5 T A 2: 119,907,703 (GRCm39) noncoding transcript Het
Sun5 G A 2: 153,707,283 (GRCm39) R132* probably null Het
Tedc2 A G 17: 24,435,354 (GRCm39) V345A probably benign Het
Tlr6 T A 5: 65,111,739 (GRCm39) R389S probably benign Het
Ttc17 G T 2: 94,202,113 (GRCm39) H396Q probably damaging Het
Ttn A G 2: 76,773,383 (GRCm39) S2340P probably damaging Het
Vmn1r219 C T 13: 23,346,999 (GRCm39) Q63* probably null Het
Vmn1r224 A G 17: 20,639,902 (GRCm39) T160A possibly damaging Het
Vmn2r11 T C 5: 109,195,436 (GRCm39) N630S probably damaging Het
Zfp1005 T A 2: 150,109,549 (GRCm39) C80S possibly damaging Het
Zfp747 A G 7: 126,973,498 (GRCm39) V224A possibly damaging Het
Zfp804b T C 5: 6,822,250 (GRCm39) N271S probably benign Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 96,092,959 (GRCm39) missense probably benign 0.31
IGL03001:Mmp15 APN 8 96,094,845 (GRCm39) missense probably damaging 0.97
R0147:Mmp15 UTSW 8 96,098,945 (GRCm39) missense probably benign 0.18
R0148:Mmp15 UTSW 8 96,098,945 (GRCm39) missense probably benign 0.18
R0437:Mmp15 UTSW 8 96,097,400 (GRCm39) missense probably benign 0.04
R0465:Mmp15 UTSW 8 96,094,626 (GRCm39) missense probably damaging 1.00
R0548:Mmp15 UTSW 8 96,098,979 (GRCm39) missense probably damaging 1.00
R0574:Mmp15 UTSW 8 96,092,029 (GRCm39) missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 96,098,762 (GRCm39) missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 96,094,856 (GRCm39) missense probably benign 0.01
R1341:Mmp15 UTSW 8 96,098,931 (GRCm39) missense probably benign 0.03
R1428:Mmp15 UTSW 8 96,096,190 (GRCm39) missense probably benign 0.34
R1840:Mmp15 UTSW 8 96,092,048 (GRCm39) missense probably damaging 1.00
R2061:Mmp15 UTSW 8 96,097,407 (GRCm39) missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 96,096,801 (GRCm39) missense probably benign 0.38
R4760:Mmp15 UTSW 8 96,094,824 (GRCm39) missense possibly damaging 0.61
R5233:Mmp15 UTSW 8 96,097,696 (GRCm39) missense probably benign 0.08
R5394:Mmp15 UTSW 8 96,093,032 (GRCm39) missense probably damaging 0.96
R5502:Mmp15 UTSW 8 96,094,812 (GRCm39) missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 96,094,729 (GRCm39) missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 96,098,804 (GRCm39) missense probably benign 0.00
R6341:Mmp15 UTSW 8 96,092,091 (GRCm39) critical splice donor site probably null
R6720:Mmp15 UTSW 8 96,091,942 (GRCm39) missense probably benign 0.22
R7788:Mmp15 UTSW 8 96,094,776 (GRCm39) missense probably damaging 1.00
R8033:Mmp15 UTSW 8 96,094,590 (GRCm39) missense probably benign 0.01
R8679:Mmp15 UTSW 8 96,092,982 (GRCm39) missense possibly damaging 0.83
R8791:Mmp15 UTSW 8 96,096,288 (GRCm39) nonsense probably null
R9028:Mmp15 UTSW 8 96,096,316 (GRCm39) missense probably benign 0.01
R9227:Mmp15 UTSW 8 96,092,959 (GRCm39) missense probably benign 0.06
R9230:Mmp15 UTSW 8 96,092,959 (GRCm39) missense probably benign 0.06
R9350:Mmp15 UTSW 8 96,093,002 (GRCm39) missense probably damaging 0.97
R9632:Mmp15 UTSW 8 96,098,731 (GRCm39) critical splice acceptor site probably null
R9695:Mmp15 UTSW 8 96,097,414 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TAGCCTACACCTACTTCTACAAGG -3'
(R):5'- AGTGAGCGCTTGCAGTAGAG -3'

Sequencing Primer
(F):5'- CAACGAACGCCTACGGATGG -3'
(R):5'- CTTGCAGTAGAGCAGCATGC -3'
Posted On 2015-11-11