Incidental Mutation 'R4762:Parp4'
ID356984
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Namepoly (ADP-ribose) polymerase family, member 4
Synonymsp193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
MMRRC Submission 042403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4762 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56575619-56659794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56610810 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 694 (H694Q)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160334
Predicted Effect probably damaging
Transcript: ENSMUST00000161553
AA Change: H694Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: H694Q

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162231
Meta Mutation Damage Score 0.3218 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik T C 1: 158,969,556 noncoding transcript Het
2310030G06Rik T C 9: 50,740,667 E87G probably damaging Het
Aknad1 A T 3: 108,775,231 H541L possibly damaging Het
Asb15 A G 6: 24,567,237 E519G possibly damaging Het
Atad2 T C 15: 58,108,362 D373G probably benign Het
Bbs12 G A 3: 37,320,380 V326M probably damaging Het
Birc6 T C 17: 74,629,489 I2617T probably damaging Het
Brca2 A G 5: 150,531,116 T115A probably benign Het
Casz1 T C 4: 148,938,981 L495P probably damaging Het
Ccdc30 T A 4: 119,333,588 I481F probably damaging Het
Cept1 A T 3: 106,539,361 Y56* probably null Het
Cfap54 A C 10: 93,061,453 probably null Het
Cyp2j8 G T 4: 96,470,649 D344E probably damaging Het
Dido1 A T 2: 180,689,575 W27R probably damaging Het
Disp3 A G 4: 148,272,118 I95T probably damaging Het
Engase G T 11: 118,487,094 V237F possibly damaging Het
Ephb6 G A 6: 41,618,160 E703K probably damaging Het
Fnip1 T A 11: 54,466,171 F35L probably damaging Het
Fnip1 A T 11: 54,499,526 T440S probably benign Het
Fras1 T A 5: 96,731,618 H2431Q probably benign Het
Fzd4 A T 7: 89,407,716 T324S probably damaging Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm14124 T A 2: 150,267,629 C80S possibly damaging Het
Gpr84 A T 15: 103,308,600 V350E probably damaging Het
Gsto2 T C 19: 47,874,873 Y63H probably damaging Het
Gtpbp6 T C 5: 110,104,320 T449A probably damaging Het
Herc2 G A 7: 56,170,640 V2876I probably benign Het
Hnrnpa3 A G 2: 75,662,007 I152V possibly damaging Het
Hpse2 T C 19: 42,789,071 D552G possibly damaging Het
Itfg1 A G 8: 85,732,441 V460A possibly damaging Het
Jhy G A 9: 40,911,198 A548V probably benign Het
Klhl21 T A 4: 152,009,811 L290Q possibly damaging Het
Knl1 T C 2: 119,071,936 S1373P probably benign Het
Kpna2 A C 11: 106,990,259 M426R probably benign Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Lpar1 T G 4: 58,437,346 H361P possibly damaging Het
Macf1 T C 4: 123,455,444 T2100A probably benign Het
Mfsd13b T C 7: 120,991,326 F97L probably damaging Het
Mmp15 A G 8: 95,372,330 K595R probably benign Het
Mrps25 C T 6: 92,175,104 G145D probably damaging Het
Muc4 T A 16: 32,753,625 probably benign Het
Napa A T 7: 16,115,271 K245N probably benign Het
Olfr1082 A G 2: 86,594,037 S264P possibly damaging Het
Olfr1284 G A 2: 111,379,737 V246M probably damaging Het
Olfr1285 T A 2: 111,408,880 noncoding transcript Het
Olfr1386 A T 11: 49,470,285 I45F probably damaging Het
Olfr221 T A 14: 52,035,464 I216F possibly damaging Het
Olfr292 A G 7: 86,695,121 T222A probably benign Het
Olfr796 C A 10: 129,608,174 M102I probably damaging Het
Olfr898 A G 9: 38,349,281 Y60C probably damaging Het
Papss2 A T 19: 32,638,978 T195S probably benign Het
Patj C T 4: 98,405,570 R20* probably null Het
Pcdhgb8 T A 18: 37,762,366 V163E probably damaging Het
Pkd2l1 T A 19: 44,155,621 T338S probably benign Het
Ppargc1b A T 18: 61,311,257 S278R possibly damaging Het
Ppl T C 16: 5,088,982 T1150A probably benign Het
Ralgds A G 2: 28,552,152 D858G probably damaging Het
Rassf2 G A 2: 132,002,863 probably benign Het
Ring1 T C 17: 34,021,997 probably benign Het
Rusc1 A C 3: 89,091,642 S278A probably benign Het
Samd9l T C 6: 3,375,623 N546S probably benign Het
Sct A C 7: 141,279,041 probably benign Het
Slc22a12 T G 19: 6,538,444 H348P probably benign Het
Slc25a15 A G 8: 22,383,232 S143P probably damaging Het
Slc26a11 C A 11: 119,356,831 probably benign Het
Slc6a20b A G 9: 123,598,560 M428T probably damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Smoc1 G T 12: 81,167,651 W269L probably damaging Het
Sox5 C T 6: 143,861,383 probably null Het
Sp100 A G 1: 85,701,458 *483W probably null Het
Sptbn5 T A 2: 120,077,222 noncoding transcript Het
Sun5 G A 2: 153,865,363 R132* probably null Het
Tedc2 A G 17: 24,216,380 V345A probably benign Het
Tlr6 T A 5: 64,954,396 R389S probably benign Het
Ttc17 G T 2: 94,371,768 H396Q probably damaging Het
Ttn A G 2: 76,943,039 S2340P probably damaging Het
Vmn1r219 C T 13: 23,162,829 Q63* probably null Het
Vmn1r224 A G 17: 20,419,640 T160A possibly damaging Het
Vmn2r11 T C 5: 109,047,570 N630S probably damaging Het
Zfp747 A G 7: 127,374,326 V224A possibly damaging Het
Zfp804b T C 5: 6,772,250 N271S probably benign Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0320:Parp4 UTSW 14 56588496 critical splice donor site probably null
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0608:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56624095 missense probably benign 0.01
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R6995:Parp4 UTSW 14 56613739 missense probably damaging 0.97
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
R7162:Parp4 UTSW 14 56648876 missense unknown
R7293:Parp4 UTSW 14 56647846 small deletion probably benign
R7297:Parp4 UTSW 14 56647681 missense not run
R7337:Parp4 UTSW 14 56602395 missense probably damaging 1.00
R7539:Parp4 UTSW 14 56635755 missense probably damaging 1.00
R7575:Parp4 UTSW 14 56637918 missense probably benign 0.28
R7808:Parp4 UTSW 14 56635748 missense possibly damaging 0.65
R7854:Parp4 UTSW 14 56659348 missense unknown
R8152:Parp4 UTSW 14 56647246 missense probably benign 0.00
RF020:Parp4 UTSW 14 56647349 missense unknown
Z1177:Parp4 UTSW 14 56592367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTGAGCATGGCACCTCAC -3'
(R):5'- TGACCTCCTGTACTCCTAAGG -3'

Sequencing Primer
(F):5'- CTGCCATCTCAGCAAGAGGATTG -3'
(R):5'- GAGCCTTGAACTTGCAGCAATTC -3'
Posted On2015-11-11