Incidental Mutation 'R4763:Olfr142'
ID357009
Institutional Source Beutler Lab
Gene Symbol Olfr142
Ensembl Gene ENSMUSG00000075063
Gene Nameolfactory receptor 142
SynonymsGA_x6K02T2Q125-51607674-51606757, K20, MOR227-2
MMRRC Submission 042404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4763 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90250130-90257592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90252463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 175 (Y175F)
Ref Sequence ENSEMBL: ENSMUSP00000150216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099752] [ENSMUST00000213968]
Predicted Effect probably damaging
Transcript: ENSMUST00000099752
AA Change: Y175F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097341
Gene: ENSMUSG00000075063
AA Change: Y175F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 300 3e-6 PFAM
Pfam:7tm_1 39 285 5.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213968
AA Change: Y175F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik A G 9: 98,187,123 noncoding transcript Het
Abhd2 A G 7: 79,360,131 E418G probably benign Het
Acox2 G T 14: 8,241,334 H593N possibly damaging Het
Adam17 A G 12: 21,334,015 Y495H probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arhgap44 A G 11: 65,039,165 I240T probably damaging Het
Atp2c1 T C 9: 105,418,567 T653A probably damaging Het
Atxn7l1 G A 12: 33,358,878 probably benign Het
Cacng8 T C 7: 3,414,992 V220A probably damaging Het
Card14 A T 11: 119,343,175 S864C probably damaging Het
Cfap58 C T 19: 47,983,506 A625V probably damaging Het
Cfap61 T C 2: 146,017,367 V425A probably benign Het
Cfap73 A G 5: 120,630,229 F155L probably damaging Het
Cntrl G T 2: 35,175,551 R2235L probably damaging Het
Cxxc1 A G 18: 74,219,413 K355E probably damaging Het
Disc1 G A 8: 125,124,538 G387D probably damaging Het
Dpf2 T C 19: 5,902,452 Y286C probably damaging Het
E2f7 A T 10: 110,780,849 K650M probably damaging Het
Fbln2 C T 6: 91,270,000 S1027F probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gm6811 A G 17: 21,093,847 noncoding transcript Het
Gtf2i T C 5: 134,255,964 K409E probably damaging Het
Hamp T A 7: 30,942,564 R55S probably damaging Het
Heatr1 C T 13: 12,430,930 T1596I possibly damaging Het
Hells T C 19: 38,957,199 V601A probably damaging Het
Ighv5-8 A G 12: 113,653,541 S34P probably damaging Het
Lig4 T C 8: 9,972,955 D275G probably damaging Het
Med6 T C 12: 81,582,661 D59G probably damaging Het
Men1 T C 19: 6,335,072 probably null Het
Mlec G A 5: 115,157,913 A41V unknown Het
Ncoa1 G A 12: 4,275,297 T927I probably damaging Het
Neb T A 2: 52,237,040 K378* probably null Het
Neb T A 2: 52,326,720 K148* probably null Het
Olfr1287 T A 2: 111,449,678 C179* probably null Het
Olfr498 G A 7: 108,466,186 M287I probably benign Het
Olfr943 A G 9: 39,184,960 T261A probably benign Het
Parp10 C T 15: 76,233,427 V920M probably damaging Het
Parp6 C A 9: 59,631,365 P241H probably damaging Het
Pcyox1l A G 18: 61,697,779 Y341H probably benign Het
Pfas A T 11: 68,990,194 D1080E possibly damaging Het
Pi4kb G T 3: 95,004,409 probably benign Het
Piwil2 C T 14: 70,376,778 V846M probably damaging Het
Pkd1l2 A G 8: 117,019,429 F1941L probably damaging Het
Pot1b G A 17: 55,695,160 T138M possibly damaging Het
Ppp4r1 T C 17: 65,835,110 I720T possibly damaging Het
Prr12 A G 7: 45,047,695 L932S unknown Het
Rnaseh2a T A 8: 84,965,392 E84V probably benign Het
Rpl18a G A 8: 70,895,686 R118C probably benign Het
Rprm C A 2: 54,085,216 C30F possibly damaging Het
Sbf2 G T 7: 110,420,917 L579I probably damaging Het
Sfn C A 4: 133,601,345 R142L probably benign Het
St8sia6 T C 2: 13,672,530 K159E probably damaging Het
Sugct A T 13: 17,662,787 F86L probably damaging Het
Tldc1 A G 8: 119,768,383 V212A probably benign Het
Tmcc3 T C 10: 94,579,311 S292P probably damaging Het
Tmem33 A T 5: 67,286,136 I219F probably benign Het
Trav8-1 C A 14: 53,470,035 T44K possibly damaging Het
U2surp A G 9: 95,511,791 probably benign Het
Use1 T C 8: 71,367,308 L25P probably damaging Het
Vmn1r221 G T 13: 23,217,788 noncoding transcript Het
Vmn1r50 C T 6: 90,108,080 T269I probably benign Het
Washc3 A G 10: 88,219,323 D125G probably damaging Het
Zfp142 G A 1: 74,576,512 H278Y probably damaging Het
Zfp418 A G 7: 7,181,445 N136D possibly damaging Het
Other mutations in Olfr142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01623:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01810:Olfr142 APN 2 90252132 nonsense probably null
IGL01918:Olfr142 APN 2 90252331 missense probably damaging 1.00
IGL02619:Olfr142 APN 2 90252505 missense probably damaging 0.97
IGL02732:Olfr142 APN 2 90252308 missense probably damaging 1.00
IGL02738:Olfr142 APN 2 90252355 missense possibly damaging 0.82
IGL02795:Olfr142 APN 2 90252562 missense probably damaging 1.00
IGL02830:Olfr142 APN 2 90252781 missense probably damaging 1.00
R0601:Olfr142 UTSW 2 90252934 missense probably benign 0.05
R2004:Olfr142 UTSW 2 90252692 missense probably benign 0.04
R2136:Olfr142 UTSW 2 90252253 missense probably damaging 0.98
R2377:Olfr142 UTSW 2 90252911 missense probably damaging 1.00
R3615:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R3616:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R3777:Olfr142 UTSW 2 90252625 missense probably damaging 1.00
R4765:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R5421:Olfr142 UTSW 2 90252745 missense probably benign 0.01
R5426:Olfr142 UTSW 2 90252611 nonsense probably null
R6063:Olfr142 UTSW 2 90252427 missense probably benign 0.40
R6717:Olfr142 UTSW 2 90252524 missense probably benign 0.00
R6931:Olfr142 UTSW 2 90252777 nonsense probably null
R6936:Olfr142 UTSW 2 90252334 missense probably benign 0.17
R7013:Olfr142 UTSW 2 90252097 missense possibly damaging 0.87
R7091:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R7247:Olfr142 UTSW 2 90252821 missense probably damaging 1.00
R8169:Olfr142 UTSW 2 90252098 nonsense probably null
R8345:Olfr142 UTSW 2 90252217 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GAACAGGATGACCACTGTGATG -3'
(R):5'- GATGGCCTATGACCGCTATG -3'

Sequencing Primer
(F):5'- CCACTGTGATGTGAGAGGC -3'
(R):5'- GCTATGTGGCCATCTGCAAAC -3'
Posted On2015-11-11