Incidental Mutation 'R4763:Pfas'
ID357045
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Namephosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms4432409B16Rik, Sofa
MMRRC Submission 042404-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4763 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location68985697-69008460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68990194 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1080 (D1080E)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021282
AA Change: D1080E

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: D1080E

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146490
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152964
AA Change: D184E
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899
AA Change: D184E

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174986
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik A G 9: 98,187,123 noncoding transcript Het
Abhd2 A G 7: 79,360,131 E418G probably benign Het
Acox2 G T 14: 8,241,334 H593N possibly damaging Het
Adam17 A G 12: 21,334,015 Y495H probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arhgap44 A G 11: 65,039,165 I240T probably damaging Het
Atp2c1 T C 9: 105,418,567 T653A probably damaging Het
Atxn7l1 G A 12: 33,358,878 probably benign Het
Cacng8 T C 7: 3,414,992 V220A probably damaging Het
Card14 A T 11: 119,343,175 S864C probably damaging Het
Cfap58 C T 19: 47,983,506 A625V probably damaging Het
Cfap61 T C 2: 146,017,367 V425A probably benign Het
Cfap73 A G 5: 120,630,229 F155L probably damaging Het
Cntrl G T 2: 35,175,551 R2235L probably damaging Het
Cxxc1 A G 18: 74,219,413 K355E probably damaging Het
Disc1 G A 8: 125,124,538 G387D probably damaging Het
Dpf2 T C 19: 5,902,452 Y286C probably damaging Het
E2f7 A T 10: 110,780,849 K650M probably damaging Het
Fbln2 C T 6: 91,270,000 S1027F probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gm6811 A G 17: 21,093,847 noncoding transcript Het
Gtf2i T C 5: 134,255,964 K409E probably damaging Het
Hamp T A 7: 30,942,564 R55S probably damaging Het
Heatr1 C T 13: 12,430,930 T1596I possibly damaging Het
Hells T C 19: 38,957,199 V601A probably damaging Het
Ighv5-8 A G 12: 113,653,541 S34P probably damaging Het
Lig4 T C 8: 9,972,955 D275G probably damaging Het
Med6 T C 12: 81,582,661 D59G probably damaging Het
Men1 T C 19: 6,335,072 probably null Het
Mlec G A 5: 115,157,913 A41V unknown Het
Ncoa1 G A 12: 4,275,297 T927I probably damaging Het
Neb T A 2: 52,237,040 K378* probably null Het
Neb T A 2: 52,326,720 K148* probably null Het
Olfr1287 T A 2: 111,449,678 C179* probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr498 G A 7: 108,466,186 M287I probably benign Het
Olfr943 A G 9: 39,184,960 T261A probably benign Het
Parp10 C T 15: 76,233,427 V920M probably damaging Het
Parp6 C A 9: 59,631,365 P241H probably damaging Het
Pcyox1l A G 18: 61,697,779 Y341H probably benign Het
Pi4kb G T 3: 95,004,409 probably benign Het
Piwil2 C T 14: 70,376,778 V846M probably damaging Het
Pkd1l2 A G 8: 117,019,429 F1941L probably damaging Het
Pot1b G A 17: 55,695,160 T138M possibly damaging Het
Ppp4r1 T C 17: 65,835,110 I720T possibly damaging Het
Prr12 A G 7: 45,047,695 L932S unknown Het
Rnaseh2a T A 8: 84,965,392 E84V probably benign Het
Rpl18a G A 8: 70,895,686 R118C probably benign Het
Rprm C A 2: 54,085,216 C30F possibly damaging Het
Sbf2 G T 7: 110,420,917 L579I probably damaging Het
Sfn C A 4: 133,601,345 R142L probably benign Het
St8sia6 T C 2: 13,672,530 K159E probably damaging Het
Sugct A T 13: 17,662,787 F86L probably damaging Het
Tldc1 A G 8: 119,768,383 V212A probably benign Het
Tmcc3 T C 10: 94,579,311 S292P probably damaging Het
Tmem33 A T 5: 67,286,136 I219F probably benign Het
Trav8-1 C A 14: 53,470,035 T44K possibly damaging Het
U2surp A G 9: 95,511,791 probably benign Het
Use1 T C 8: 71,367,308 L25P probably damaging Het
Vmn1r221 G T 13: 23,217,788 noncoding transcript Het
Vmn1r50 C T 6: 90,108,080 T269I probably benign Het
Washc3 A G 10: 88,219,323 D125G probably damaging Het
Zfp142 G A 1: 74,576,512 H278Y probably damaging Het
Zfp418 A G 7: 7,181,445 N136D possibly damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 unclassified probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1871:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2026:Pfas UTSW 11 68993957 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4437:Pfas UTSW 11 68988417 missense probably damaging 1.00
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5328:Pfas UTSW 11 68988592 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6387:Pfas UTSW 11 69000465 missense probably damaging 1.00
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7386:Pfas UTSW 11 69003774 missense probably benign
R7424:Pfas UTSW 11 69000092 missense probably damaging 1.00
R7459:Pfas UTSW 11 68988655 missense
Predicted Primers PCR Primer
(F):5'- TGACCTTTAGCAGAGCCCAG -3'
(R):5'- TGCCCTGTAAACCTGGTAAG -3'

Sequencing Primer
(F):5'- TTTAGCAGAGCCCAGGACGTC -3'
(R):5'- CTGGTAAGGGAGCGTGCAC -3'
Posted On2015-11-11