Incidental Mutation 'R4763:Adam17'
ID357049
Institutional Source Beutler Lab
Gene Symbol Adam17
Ensembl Gene ENSMUSG00000052593
Gene Namea disintegrin and metallopeptidase domain 17
SynonymsCD156b, Tace
MMRRC Submission 042404-MU
Accession Numbers

Genbank: NM_009615; MGI: 1096335

Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R4763 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location21323509-21373632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21334015 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 495 (Y495H)
Ref Sequence ENSEMBL: ENSMUSP00000136407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064536] [ENSMUST00000101551] [ENSMUST00000127974] [ENSMUST00000145118] [ENSMUST00000232107] [ENSMUST00000232526]
Predicted Effect probably benign
Transcript: ENSMUST00000064536
AA Change: Y495H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593
AA Change: Y495H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 1.1e-11 PFAM
Pfam:Reprolysin_5 221 451 6.7e-37 PFAM
Pfam:Reprolysin_4 221 469 3.2e-24 PFAM
Pfam:Reprolysin_2 244 464 8.8e-29 PFAM
Pfam:Reprolysin_3 248 416 1.2e-12 PFAM
Pfam:Reprolysin 383 474 3.1e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 642 4e-32 PDB
transmembrane domain 672 694 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101551
AA Change: Y514H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593
AA Change: Y514H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 167 9.7e-15 PFAM
Pfam:Reprolysin_5 221 470 5e-34 PFAM
Pfam:Reprolysin_4 221 488 6.1e-20 PFAM
Pfam:Reprolysin_2 264 483 2.6e-34 PFAM
Pfam:Reprolysin_3 267 435 2.8e-14 PFAM
Pfam:Reprolysin 330 493 5.3e-9 PFAM
DISIN 503 580 6.27e-26 SMART
Pfam:ADAM17_MPD 600 661 1e-23 PFAM
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 758 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127974
SMART Domains Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 25 167 9.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141799
Predicted Effect probably benign
Transcript: ENSMUST00000145118
AA Change: Y495H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593
AA Change: Y495H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 7.5e-12 PFAM
Pfam:Reprolysin_5 221 451 4.2e-37 PFAM
Pfam:Reprolysin_4 221 469 2e-24 PFAM
Pfam:Reprolysin_2 244 464 5.6e-29 PFAM
Pfam:Reprolysin_3 248 416 7.8e-13 PFAM
Pfam:Reprolysin 381 474 2.2e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 638 5e-29 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155115
Predicted Effect probably benign
Transcript: ENSMUST00000232107
Predicted Effect probably benign
Transcript: ENSMUST00000232526
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero or fail to survive beyond one week of age. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die perinatally with stunted vibrissae and open eyelids. Survivors display various degrees of eye degeneration, perturbed hair coats, curly vibrissae, and irregular pigmentation patterns. Histological analysis of fetuses reveal defects in epithelial cell maturation and organization in multiple organs. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(8)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik A G 9: 98,187,123 noncoding transcript Het
Abhd2 A G 7: 79,360,131 E418G probably benign Het
Acox2 G T 14: 8,241,334 H593N possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arhgap44 A G 11: 65,039,165 I240T probably damaging Het
Atp2c1 T C 9: 105,418,567 T653A probably damaging Het
Atxn7l1 G A 12: 33,358,878 probably benign Het
Cacng8 T C 7: 3,414,992 V220A probably damaging Het
Card14 A T 11: 119,343,175 S864C probably damaging Het
Cfap58 C T 19: 47,983,506 A625V probably damaging Het
Cfap61 T C 2: 146,017,367 V425A probably benign Het
Cfap73 A G 5: 120,630,229 F155L probably damaging Het
Cntrl G T 2: 35,175,551 R2235L probably damaging Het
Cxxc1 A G 18: 74,219,413 K355E probably damaging Het
Disc1 G A 8: 125,124,538 G387D probably damaging Het
Dpf2 T C 19: 5,902,452 Y286C probably damaging Het
E2f7 A T 10: 110,780,849 K650M probably damaging Het
Fbln2 C T 6: 91,270,000 S1027F probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gm6811 A G 17: 21,093,847 noncoding transcript Het
Gtf2i T C 5: 134,255,964 K409E probably damaging Het
Hamp T A 7: 30,942,564 R55S probably damaging Het
Heatr1 C T 13: 12,430,930 T1596I possibly damaging Het
Hells T C 19: 38,957,199 V601A probably damaging Het
Ighv5-8 A G 12: 113,653,541 S34P probably damaging Het
Lig4 T C 8: 9,972,955 D275G probably damaging Het
Med6 T C 12: 81,582,661 D59G probably damaging Het
Men1 T C 19: 6,335,072 probably null Het
Mlec G A 5: 115,157,913 A41V unknown Het
Ncoa1 G A 12: 4,275,297 T927I probably damaging Het
Neb T A 2: 52,237,040 K378* probably null Het
Neb T A 2: 52,326,720 K148* probably null Het
Olfr1287 T A 2: 111,449,678 C179* probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr498 G A 7: 108,466,186 M287I probably benign Het
Olfr943 A G 9: 39,184,960 T261A probably benign Het
Parp10 C T 15: 76,233,427 V920M probably damaging Het
Parp6 C A 9: 59,631,365 P241H probably damaging Het
Pcyox1l A G 18: 61,697,779 Y341H probably benign Het
Pfas A T 11: 68,990,194 D1080E possibly damaging Het
Pi4kb G T 3: 95,004,409 probably benign Het
Piwil2 C T 14: 70,376,778 V846M probably damaging Het
Pkd1l2 A G 8: 117,019,429 F1941L probably damaging Het
Pot1b G A 17: 55,695,160 T138M possibly damaging Het
Ppp4r1 T C 17: 65,835,110 I720T possibly damaging Het
Prr12 A G 7: 45,047,695 L932S unknown Het
Rnaseh2a T A 8: 84,965,392 E84V probably benign Het
Rpl18a G A 8: 70,895,686 R118C probably benign Het
Rprm C A 2: 54,085,216 C30F possibly damaging Het
Sbf2 G T 7: 110,420,917 L579I probably damaging Het
Sfn C A 4: 133,601,345 R142L probably benign Het
St8sia6 T C 2: 13,672,530 K159E probably damaging Het
Sugct A T 13: 17,662,787 F86L probably damaging Het
Tldc1 A G 8: 119,768,383 V212A probably benign Het
Tmcc3 T C 10: 94,579,311 S292P probably damaging Het
Tmem33 A T 5: 67,286,136 I219F probably benign Het
Trav8-1 C A 14: 53,470,035 T44K possibly damaging Het
U2surp A G 9: 95,511,791 probably benign Het
Use1 T C 8: 71,367,308 L25P probably damaging Het
Vmn1r221 G T 13: 23,217,788 noncoding transcript Het
Vmn1r50 C T 6: 90,108,080 T269I probably benign Het
Washc3 A G 10: 88,219,323 D125G probably damaging Het
Zfp142 G A 1: 74,576,512 H278Y probably damaging Het
Zfp418 A G 7: 7,181,445 N136D possibly damaging Het
Other mutations in Adam17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Adam17 APN 12 21328109 missense probably damaging 1.00
IGL01340:Adam17 APN 12 21330057 nonsense probably null
IGL01973:Adam17 APN 12 21349943 missense probably damaging 1.00
IGL02223:Adam17 APN 12 21361705 missense possibly damaging 0.92
IGL03153:Adam17 APN 12 21345697 missense probably damaging 1.00
Steinway UTSW 12 21353948 missense probably damaging 1.00
wavedx UTSW 12 21340750 missense probably damaging 1.00
R0014:Adam17 UTSW 12 21336644 missense probably benign 0.36
R0080:Adam17 UTSW 12 21329048 splice site probably benign
R0082:Adam17 UTSW 12 21329048 splice site probably benign
R0324:Adam17 UTSW 12 21349938 missense probably benign 0.00
R0511:Adam17 UTSW 12 21340458 splice site probably benign
R0745:Adam17 UTSW 12 21332221 splice site probably benign
R1314:Adam17 UTSW 12 21329071 missense probably damaging 1.00
R1547:Adam17 UTSW 12 21353957 missense probably damaging 1.00
R1594:Adam17 UTSW 12 21340470 critical splice donor site probably null
R1607:Adam17 UTSW 12 21334138 intron probably null
R1812:Adam17 UTSW 12 21361767 missense probably damaging 0.97
R2020:Adam17 UTSW 12 21349875 missense probably damaging 1.00
R3408:Adam17 UTSW 12 21329118 missense probably damaging 1.00
R3735:Adam17 UTSW 12 21325412 missense probably benign 0.05
R3886:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R3888:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R4062:Adam17 UTSW 12 21325457 missense probably damaging 1.00
R4415:Adam17 UTSW 12 21345701 missense possibly damaging 0.90
R4563:Adam17 UTSW 12 21332088 missense probably damaging 1.00
R4658:Adam17 UTSW 12 21332160 missense probably damaging 1.00
R4793:Adam17 UTSW 12 21347395 missense probably benign
R5101:Adam17 UTSW 12 21373405 missense possibly damaging 0.85
R5120:Adam17 UTSW 12 21343019 intron probably benign
R5514:Adam17 UTSW 12 21340519 missense probably damaging 0.98
R5592:Adam17 UTSW 12 21334137 missense probably damaging 1.00
R5874:Adam17 UTSW 12 21329086 missense possibly damaging 0.76
R6110:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6451:Adam17 UTSW 12 21342882 missense probably benign 0.00
R6930:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6970:Adam17 UTSW 12 21345668 missense probably benign 0.06
R7213:Adam17 UTSW 12 21336678 nonsense probably null
R7302:Adam17 UTSW 12 21355693 intron probably benign
R7361:Adam17 UTSW 12 21325601 missense probably damaging 0.98
R7667:Adam17 UTSW 12 21333952 critical splice donor site probably null
R7799:Adam17 UTSW 12 21340492 missense probably damaging 1.00
X0063:Adam17 UTSW 12 21332585 missense probably benign 0.17
Z1176:Adam17 UTSW 12 21361737 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAGGCAGTTGTCACCAAG -3'
(R):5'- GCGAATGCATTCATCTTGGTC -3'

Sequencing Primer
(F):5'- AAGTAGATGGATCTCTTTGAGTTCC -3'
(R):5'- GCGAATGCATTCATCTTGGTCTTTTC -3'
Posted On2015-11-11