Incidental Mutation 'R4763:Acox2'
ID357057
Institutional Source Beutler Lab
Gene Symbol Acox2
Ensembl Gene ENSMUSG00000021751
Gene Nameacyl-Coenzyme A oxidase 2, branched chain
Synonyms
MMRRC Submission 042404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4763 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location8225511-8259353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8241334 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 593 (H593N)
Ref Sequence ENSEMBL: ENSMUSP00000126464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022271] [ENSMUST00000164598]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022271
AA Change: H593N

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022271
Gene: ENSMUSG00000021751
AA Change: H593N

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 1.2e-28 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 492 677 3.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116361
Predicted Effect possibly damaging
Transcript: ENSMUST00000164598
AA Change: H593N

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126464
Gene: ENSMUSG00000021751
AA Change: H593N

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 6.3e-29 PFAM
Pfam:Acyl-CoA_dh_M 150 260 2.8e-11 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 495 675 1.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165169
Meta Mutation Damage Score 0.0855 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe mental retardation, and death in children. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice heterozygous for an endonuclease-mediated deletion exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik A G 9: 98,187,123 noncoding transcript Het
Abhd2 A G 7: 79,360,131 E418G probably benign Het
Adam17 A G 12: 21,334,015 Y495H probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arhgap44 A G 11: 65,039,165 I240T probably damaging Het
Atp2c1 T C 9: 105,418,567 T653A probably damaging Het
Atxn7l1 G A 12: 33,358,878 probably benign Het
Cacng8 T C 7: 3,414,992 V220A probably damaging Het
Card14 A T 11: 119,343,175 S864C probably damaging Het
Cfap58 C T 19: 47,983,506 A625V probably damaging Het
Cfap61 T C 2: 146,017,367 V425A probably benign Het
Cfap73 A G 5: 120,630,229 F155L probably damaging Het
Cntrl G T 2: 35,175,551 R2235L probably damaging Het
Cxxc1 A G 18: 74,219,413 K355E probably damaging Het
Disc1 G A 8: 125,124,538 G387D probably damaging Het
Dpf2 T C 19: 5,902,452 Y286C probably damaging Het
E2f7 A T 10: 110,780,849 K650M probably damaging Het
Fbln2 C T 6: 91,270,000 S1027F probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gm6811 A G 17: 21,093,847 noncoding transcript Het
Gtf2i T C 5: 134,255,964 K409E probably damaging Het
Hamp T A 7: 30,942,564 R55S probably damaging Het
Heatr1 C T 13: 12,430,930 T1596I possibly damaging Het
Hells T C 19: 38,957,199 V601A probably damaging Het
Ighv5-8 A G 12: 113,653,541 S34P probably damaging Het
Lig4 T C 8: 9,972,955 D275G probably damaging Het
Med6 T C 12: 81,582,661 D59G probably damaging Het
Men1 T C 19: 6,335,072 probably null Het
Mlec G A 5: 115,157,913 A41V unknown Het
Ncoa1 G A 12: 4,275,297 T927I probably damaging Het
Neb T A 2: 52,237,040 K378* probably null Het
Neb T A 2: 52,326,720 K148* probably null Het
Olfr1287 T A 2: 111,449,678 C179* probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr498 G A 7: 108,466,186 M287I probably benign Het
Olfr943 A G 9: 39,184,960 T261A probably benign Het
Parp10 C T 15: 76,233,427 V920M probably damaging Het
Parp6 C A 9: 59,631,365 P241H probably damaging Het
Pcyox1l A G 18: 61,697,779 Y341H probably benign Het
Pfas A T 11: 68,990,194 D1080E possibly damaging Het
Pi4kb G T 3: 95,004,409 probably benign Het
Piwil2 C T 14: 70,376,778 V846M probably damaging Het
Pkd1l2 A G 8: 117,019,429 F1941L probably damaging Het
Pot1b G A 17: 55,695,160 T138M possibly damaging Het
Ppp4r1 T C 17: 65,835,110 I720T possibly damaging Het
Prr12 A G 7: 45,047,695 L932S unknown Het
Rnaseh2a T A 8: 84,965,392 E84V probably benign Het
Rpl18a G A 8: 70,895,686 R118C probably benign Het
Rprm C A 2: 54,085,216 C30F possibly damaging Het
Sbf2 G T 7: 110,420,917 L579I probably damaging Het
Sfn C A 4: 133,601,345 R142L probably benign Het
St8sia6 T C 2: 13,672,530 K159E probably damaging Het
Sugct A T 13: 17,662,787 F86L probably damaging Het
Tldc1 A G 8: 119,768,383 V212A probably benign Het
Tmcc3 T C 10: 94,579,311 S292P probably damaging Het
Tmem33 A T 5: 67,286,136 I219F probably benign Het
Trav8-1 C A 14: 53,470,035 T44K possibly damaging Het
U2surp A G 9: 95,511,791 probably benign Het
Use1 T C 8: 71,367,308 L25P probably damaging Het
Vmn1r221 G T 13: 23,217,788 noncoding transcript Het
Vmn1r50 C T 6: 90,108,080 T269I probably benign Het
Washc3 A G 10: 88,219,323 D125G probably damaging Het
Zfp142 G A 1: 74,576,512 H278Y probably damaging Het
Zfp418 A G 7: 7,181,445 N136D possibly damaging Het
Other mutations in Acox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Acox2 APN 14 8246363 missense probably damaging 1.00
IGL01845:Acox2 APN 14 8251617 missense probably damaging 1.00
IGL02830:Acox2 APN 14 8255298 missense probably damaging 1.00
R0415:Acox2 UTSW 14 8243835 splice site probably benign
R0535:Acox2 UTSW 14 8256753 missense probably damaging 1.00
R1424:Acox2 UTSW 14 8230247 missense probably benign 0.02
R1836:Acox2 UTSW 14 8248059 missense possibly damaging 0.91
R1862:Acox2 UTSW 14 8241416 missense probably benign 0.07
R1885:Acox2 UTSW 14 8248102 missense probably benign 0.00
R2032:Acox2 UTSW 14 8246400 missense probably benign 0.00
R2268:Acox2 UTSW 14 8253496 missense probably damaging 0.98
R2497:Acox2 UTSW 14 8251612 missense probably benign 0.00
R3032:Acox2 UTSW 14 8253466 missense probably damaging 1.00
R3842:Acox2 UTSW 14 8251543 missense probably damaging 1.00
R3874:Acox2 UTSW 14 8248061 missense probably benign 0.00
R5072:Acox2 UTSW 14 8241374 nonsense probably null
R5397:Acox2 UTSW 14 8243803 missense probably benign 0.02
R5950:Acox2 UTSW 14 8255793 missense probably benign
R7188:Acox2 UTSW 14 8252996 missense possibly damaging 0.67
R7208:Acox2 UTSW 14 8241303 missense probably benign 0.27
R7315:Acox2 UTSW 14 8256139 missense probably damaging 0.99
R7757:Acox2 UTSW 14 8230166 missense probably damaging 1.00
R7888:Acox2 UTSW 14 8246415 missense probably benign 0.00
R8269:Acox2 UTSW 14 8246325 missense probably benign 0.00
Z1177:Acox2 UTSW 14 8256852 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAATTGTGCTAAGTGTCAGCTTGTC -3'
(R):5'- AGCCATCTTGCCAAGTTTCC -3'

Sequencing Primer
(F):5'- TCTAGGCCCCAAGTTTGCAAG -3'
(R):5'- CATCTTGCCAAGTTTCCAGAATG -3'
Posted On2015-11-11