Mutagenetix > Incidental Mutation

Incidental Mutation 'R4763:Piwil2'

357060

Institutional Source

Beutler Lab

Gene Symbol

Piwil2

Ensembl Gene

ENSMUSG00000033644

Gene Name

piwi-like RNA-mediated gene silencing 2

Synonyms

Miwi like, mili

MMRRC Submission

042404-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4763 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70372477-70429383 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70376778 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 846 (V846M)

Ref Sequence

ENSEMBL: ENSMUSP00000047385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048129]

AlphaFold

Q8CDG1

PDB Structure

Structure of extended Tudor domain TD3 from mouse TDRD1 in complex with MILI peptide containing dimethylarginine 45. [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048129
AA Change: V846M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000047385
Gene: ENSMUSG00000033644
AA Change: V846M

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
low complexity region	90	102	N/A	INTRINSIC
low complexity region	176	190	N/A	INTRINSIC
DUF1785	335	386	7.44e-2	SMART
PAZ	386	524	1.92e-62	SMART
Piwi	666	957	2.45e-119	SMART

Meta Mutation Damage Score

0.4147

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL2 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testis weight, azoospermia, and male infertility associated with a complete arrest of spermatogenesis and increased apoptotic cell death during the early prophase of the first meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610303G11Rik	A	G	9: 98,187,123		noncoding transcript	Het
Abhd2	A	G	7: 79,360,131	E418G	probably benign	Het
Acox2	G	T	14: 8,241,334	H593N	possibly damaging	Het
Adam17	A	G	12: 21,334,015	Y495H	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Arhgap44	A	G	11: 65,039,165	I240T	probably damaging	Het
Atp2c1	T	C	9: 105,418,567	T653A	probably damaging	Het
Atxn7l1	G	A	12: 33,358,878		probably benign	Het
Cacng8	T	C	7: 3,414,992	V220A	probably damaging	Het
Card14	A	T	11: 119,343,175	S864C	probably damaging	Het
Cfap58	C	T	19: 47,983,506	A625V	probably damaging	Het
Cfap61	T	C	2: 146,017,367	V425A	probably benign	Het
Cfap73	A	G	5: 120,630,229	F155L	probably damaging	Het
Cntrl	G	T	2: 35,175,551	R2235L	probably damaging	Het
Cxxc1	A	G	18: 74,219,413	K355E	probably damaging	Het
Disc1	G	A	8: 125,124,538	G387D	probably damaging	Het
Dpf2	T	C	19: 5,902,452	Y286C	probably damaging	Het
E2f7	A	T	10: 110,780,849	K650M	probably damaging	Het
Fbln2	C	T	6: 91,270,000	S1027F	probably damaging	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gm6811	A	G	17: 21,093,847		noncoding transcript	Het
Gtf2i	T	C	5: 134,255,964	K409E	probably damaging	Het
Hamp	T	A	7: 30,942,564	R55S	probably damaging	Het
Heatr1	C	T	13: 12,430,930	T1596I	possibly damaging	Het
Hells	T	C	19: 38,957,199	V601A	probably damaging	Het
Ighv5-8	A	G	12: 113,653,541	S34P	probably damaging	Het
Lig4	T	C	8: 9,972,955	D275G	probably damaging	Het
Med6	T	C	12: 81,582,661	D59G	probably damaging	Het
Men1	T	C	19: 6,335,072		probably null	Het
Mlec	G	A	5: 115,157,913	A41V	unknown	Het
Ncoa1	G	A	12: 4,275,297	T927I	probably damaging	Het
Neb	T	A	2: 52,237,040	K378*	probably null	Het
Neb	T	A	2: 52,326,720	K148*	probably null	Het
Olfr1287	T	A	2: 111,449,678	C179*	probably null	Het
Olfr142	T	A	2: 90,252,463	Y175F	probably damaging	Het
Olfr498	G	A	7: 108,466,186	M287I	probably benign	Het
Olfr943	A	G	9: 39,184,960	T261A	probably benign	Het
Parp10	C	T	15: 76,233,427	V920M	probably damaging	Het
Parp6	C	A	9: 59,631,365	P241H	probably damaging	Het
Pcyox1l	A	G	18: 61,697,779	Y341H	probably benign	Het
Pfas	A	T	11: 68,990,194	D1080E	possibly damaging	Het
Pi4kb	G	T	3: 95,004,409		probably benign	Het
Pkd1l2	A	G	8: 117,019,429	F1941L	probably damaging	Het
Pot1b	G	A	17: 55,695,160	T138M	possibly damaging	Het
Ppp4r1	T	C	17: 65,835,110	I720T	possibly damaging	Het
Prr12	A	G	7: 45,047,695	L932S	unknown	Het
Rnaseh2a	T	A	8: 84,965,392	E84V	probably benign	Het
Rpl18a	G	A	8: 70,895,686	R118C	probably benign	Het
Rprm	C	A	2: 54,085,216	C30F	possibly damaging	Het
Sbf2	G	T	7: 110,420,917	L579I	probably damaging	Het
Sfn	C	A	4: 133,601,345	R142L	probably benign	Het
St8sia6	T	C	2: 13,672,530	K159E	probably damaging	Het
Sugct	A	T	13: 17,662,787	F86L	probably damaging	Het
Tldc1	A	G	8: 119,768,383	V212A	probably benign	Het
Tmcc3	T	C	10: 94,579,311	S292P	probably damaging	Het
Tmem33	A	T	5: 67,286,136	I219F	probably benign	Het
Trav8-1	C	A	14: 53,470,035	T44K	possibly damaging	Het
U2surp	A	G	9: 95,511,791		probably benign	Het
Use1	T	C	8: 71,367,308	L25P	probably damaging	Het
Vmn1r221	G	T	13: 23,217,788		noncoding transcript	Het
Vmn1r50	C	T	6: 90,108,080	T269I	probably benign	Het
Washc3	A	G	10: 88,219,323	D125G	probably damaging	Het
Zfp142	G	A	1: 74,576,512	H278Y	probably damaging	Het
Zfp418	A	G	7: 7,181,445	N136D	possibly damaging	Het

Other mutations in Piwil2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01474:Piwil2	APN	14	70398218	missense	probably benign	0.35
IGL02215:Piwil2	APN	14	70391373	missense	possibly damaging	0.50
IGL02427:Piwil2	APN	14	70398134	splice site	probably benign
IGL02554:Piwil2	APN	14	70391486	splice site	probably benign
R0257:Piwil2	UTSW	14	70422631	missense	probably benign	0.00
R0566:Piwil2	UTSW	14	70410394	missense	probably damaging	0.99
R0800:Piwil2	UTSW	14	70409037	unclassified	probably benign
R0828:Piwil2	UTSW	14	70376017	missense	probably damaging	1.00
R0862:Piwil2	UTSW	14	70395374	missense	probably benign	0.00
R0864:Piwil2	UTSW	14	70395374	missense	probably benign	0.00
R0881:Piwil2	UTSW	14	70408927	missense	probably benign	0.34
R1734:Piwil2	UTSW	14	70426505	critical splice donor site	probably null
R1997:Piwil2	UTSW	14	70426658	missense	possibly damaging	0.90
R2011:Piwil2	UTSW	14	70426634	missense	probably damaging	1.00
R2043:Piwil2	UTSW	14	70391470	missense	probably benign	0.00
R2347:Piwil2	UTSW	14	70408917	missense	probably damaging	0.98
R2998:Piwil2	UTSW	14	70411238	missense	probably damaging	1.00
R4402:Piwil2	UTSW	14	70408916	missense	probably benign	0.01
R4455:Piwil2	UTSW	14	70390565	missense	probably benign	0.02
R4611:Piwil2	UTSW	14	70402197	missense	probably benign	0.07
R4869:Piwil2	UTSW	14	70395362	missense	probably benign	0.00
R5033:Piwil2	UTSW	14	70421593	missense	possibly damaging	0.71
R5207:Piwil2	UTSW	14	70392517	missense	probably damaging	1.00
R5395:Piwil2	UTSW	14	70395397	missense	probably benign	0.01
R5486:Piwil2	UTSW	14	70401431	missense	probably benign	0.01
R5504:Piwil2	UTSW	14	70389899	missense	probably benign	0.01
R5629:Piwil2	UTSW	14	70422967	missense	probably damaging	1.00
R5967:Piwil2	UTSW	14	70390564	missense	probably benign	0.00
R6167:Piwil2	UTSW	14	70422893	critical splice donor site	probably null
R6168:Piwil2	UTSW	14	70395351	missense	probably benign	0.04
R6517:Piwil2	UTSW	14	70374336	missense	probably benign	0.44
R7261:Piwil2	UTSW	14	70374411	missense	probably damaging	1.00
R7727:Piwil2	UTSW	14	70394057	missense	probably damaging	1.00
R7745:Piwil2	UTSW	14	70394189	missense	probably benign
R7833:Piwil2	UTSW	14	70395441	missense	probably benign	0.02
R8044:Piwil2	UTSW	14	70391438	missense	possibly damaging	0.90
R8066:Piwil2	UTSW	14	70420719	missense	probably benign	0.00
R8516:Piwil2	UTSW	14	70420739	missense	probably benign	0.19
R9015:Piwil2	UTSW	14	70390535	missense	probably benign	0.00
R9494:Piwil2	UTSW	14	70422972	missense	probably benign	0.05
X0023:Piwil2	UTSW	14	70398199	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGACAACTTCTCCAGCTTACTC -3'
(R):5'- AGTTCCAACCGCCAAGTCTC -3'

Sequencing Primer
(F):5'- AGCTTACTCTTCTGCAACTGAGG -3'
(R):5'- ATGAGTGCGAGCTTGGTCCAC -3'

Posted On

2015-11-11