Incidental Mutation 'R4764:Alg5'
ID357081
Institutional Source Beutler Lab
Gene Symbol Alg5
Ensembl Gene ENSMUSG00000036632
Gene Nameasparagine-linked glycosylation 5 (dolichyl-phosphate beta-glucosyltransferase)
Synonyms2600005J22Rik, 1500026A19Rik
MMRRC Submission 042405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54735539-54751318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54746473 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 210 (Y210C)
Ref Sequence ENSEMBL: ENSMUSP00000035879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044567] [ENSMUST00000141191] [ENSMUST00000155273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044567
AA Change: Y210C

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035879
Gene: ENSMUSG00000036632
AA Change: Y210C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 63 174 2.1e-10 PFAM
Pfam:Glycos_transf_2 68 250 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141191
SMART Domains Protein: ENSMUSP00000118818
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155273
SMART Domains Protein: ENSMUSP00000119260
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Meta Mutation Damage Score 0.2176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
PHENOTYPE: Embryos homozygous for an ENU-induced mutation arrest unturned at E9.5 and display no left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Alg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Alg5 APN 3 54744719 splice site probably benign
R2008:Alg5 UTSW 3 54746473 missense possibly damaging 0.92
R3428:Alg5 UTSW 3 54735585 start codon destroyed probably null
R3547:Alg5 UTSW 3 54749315 missense probably benign 0.15
R4372:Alg5 UTSW 3 54738955 critical splice donor site probably null
R5128:Alg5 UTSW 3 54742137 splice site probably null
R5476:Alg5 UTSW 3 54746598 missense probably benign 0.01
R5638:Alg5 UTSW 3 54738833 missense probably benign 0.22
R6880:Alg5 UTSW 3 54738843 missense probably damaging 1.00
R6897:Alg5 UTSW 3 54748642 missense probably benign
R7317:Alg5 UTSW 3 54749331 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCAGGAATCAGTAACTGC -3'
(R):5'- TGACAAGCCTGTGTCCAGTTG -3'

Sequencing Primer
(F):5'- GGAATCAGTAACTGCACCCATAG -3'
(R):5'- AGTTGTCTGGATGCCCACG -3'
Posted On2015-11-11