Incidental Mutation 'R4764:Lef1'
ID357082
Institutional Source Beutler Lab
Gene Symbol Lef1
Ensembl Gene ENSMUSG00000027985
Gene Namelymphoid enhancer binding factor 1
Synonymslymphoid enhancer factor 1, Lef-1
MMRRC Submission 042405-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location131110471-131224356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131184733 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 167 (S167P)
Ref Sequence ENSEMBL: ENSMUSP00000101948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029611] [ENSMUST00000066849] [ENSMUST00000098611] [ENSMUST00000106341]
Predicted Effect probably benign
Transcript: ENSMUST00000029611
AA Change: S167P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029611
Gene: ENSMUSG00000027985
AA Change: S167P

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 5e-88 PFAM
low complexity region 245 259 N/A INTRINSIC
HMG 296 366 7.68e-23 SMART
low complexity region 372 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066849
AA Change: S167P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067808
Gene: ENSMUSG00000027985
AA Change: S167P

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098611
AA Change: S101P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096211
Gene: ENSMUSG00000027985
AA Change: S101P

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 145 2.8e-54 PFAM
low complexity region 179 193 N/A INTRINSIC
HMG 230 300 7.68e-23 SMART
low complexity region 306 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106341
AA Change: S167P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101948
Gene: ENSMUSG00000027985
AA Change: S167P

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1.3e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200166
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele are small and die postnatally showing lack of teeth, mammary and uterine glands, whiskers, body hair, dermal-associated fat, and a dentate gyrus, as well as defects in hippocampus morphology, hair follicle development, retinal vasculature, and vascular regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Lef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Lef1 APN 3 131113850 splice site probably benign
IGL00515:Lef1 APN 3 131204277 missense probably damaging 1.00
IGL00780:Lef1 APN 3 131193130 missense possibly damaging 0.69
IGL02057:Lef1 APN 3 131200402 nonsense probably null
IGL02556:Lef1 APN 3 131194793 splice site probably null
IGL02804:Lef1 APN 3 131194689 missense probably damaging 1.00
IGL03143:Lef1 APN 3 131200316 nonsense probably null
IGL03169:Lef1 APN 3 131194663 missense probably damaging 1.00
R0470:Lef1 UTSW 3 131112826 intron probably benign
R1354:Lef1 UTSW 3 131194668 missense probably damaging 1.00
R1677:Lef1 UTSW 3 131200289 splice site probably benign
R1860:Lef1 UTSW 3 131111641 missense probably damaging 0.99
R2013:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R2015:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R3440:Lef1 UTSW 3 131184758 missense probably damaging 1.00
R3736:Lef1 UTSW 3 131191066 missense possibly damaging 0.51
R3918:Lef1 UTSW 3 131111641 missense probably damaging 0.99
R4052:Lef1 UTSW 3 131194689 missense probably damaging 1.00
R4346:Lef1 UTSW 3 131194708 missense probably damaging 1.00
R4608:Lef1 UTSW 3 131184733 missense probably benign 0.00
R4786:Lef1 UTSW 3 131111524 missense probably damaging 0.99
R5298:Lef1 UTSW 3 131194667 missense possibly damaging 0.80
R5394:Lef1 UTSW 3 131194659 missense probably damaging 1.00
R6827:Lef1 UTSW 3 131200404 critical splice donor site probably null
R6893:Lef1 UTSW 3 131115500 missense possibly damaging 0.77
R6974:Lef1 UTSW 3 131111574 missense probably damaging 1.00
R7541:Lef1 UTSW 3 131191099 missense probably benign 0.00
R7544:Lef1 UTSW 3 131194765 missense probably damaging 1.00
R7652:Lef1 UTSW 3 131200354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGACTGCCTACTGCTCCTG -3'
(R):5'- TTCTGAAGAACTGCCAGCC -3'

Sequencing Primer
(F):5'- ACTGCTCCTGCGTGACATC -3'
(R):5'- TGCCAGCCAACTGTACG -3'
Posted On2015-11-11