Incidental Mutation 'R4764:Frem1'
ID357085
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
MMRRC Submission 042405-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82989189 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 811 (D811E)
Ref Sequence ENSEMBL: ENSMUSP00000125809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect probably damaging
Transcript: ENSMUST00000071708
AA Change: D829E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: D829E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107230
AA Change: D810E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: D810E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131102
Predicted Effect probably damaging
Transcript: ENSMUST00000170248
AA Change: D811E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: D811E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Meta Mutation Damage Score 0.6125 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 intron probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7753:Frem1 UTSW 4 82913980 missense probably benign 0.03
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7886:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7960:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7961:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7969:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7984:Frem1 UTSW 4 82959377 missense probably benign 0.02
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTGATCCAGATAGAAAGCATAG -3'
(R):5'- TGCAGCTGTGGATCAATCTCC -3'

Sequencing Primer
(F):5'- GCATAGAAGGGAAACACAAAATCTTC -3'
(R):5'- ACTTGGCCCTTGAAGATGGTACC -3'
Posted On2015-11-11