Incidental Mutation 'R4764:Hrh1'
ID357091
Institutional Source Beutler Lab
Gene Symbol Hrh1
Ensembl Gene ENSMUSG00000053004
Gene Namehistamine receptor H1
SynonymsHir, Bphs
MMRRC Submission 042405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location114397936-114483296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114480535 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 259 (V259A)
Ref Sequence ENSEMBL: ENSMUSP00000124460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088987] [ENSMUST00000160212] [ENSMUST00000160780] [ENSMUST00000161220] [ENSMUST00000161650]
Predicted Effect probably benign
Transcript: ENSMUST00000088987
AA Change: V259A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000086383
Gene: ENSMUSG00000053004
AA Change: V259A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160212
Predicted Effect probably benign
Transcript: ENSMUST00000160780
AA Change: V259A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124320
Gene: ENSMUSG00000053004
AA Change: V259A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 3.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161220
AA Change: V259A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124037
Gene: ENSMUSG00000053004
AA Change: V259A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161650
AA Change: V259A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124460
Gene: ENSMUSG00000053004
AA Change: V259A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. The protein encoded by this gene is an integral membrane protein and belongs to the G protein-coupled receptor superfamily. It mediates the contraction of smooth muscles, the increase in capillary permeability due to contraction of terminal venules, the release of catecholamine from adrenal medulla, and neurotransmission in the central nervous system. It has been associated with multiple processes, including memory and learning, circadian rhythm, and thermoregulation. It is also known to contribute to the pathophysiology of allergic diseases such as atopic dermatitis, asthma, anaphylaxis and allergic rhinitis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mutants show decrease in exploratory behavior, diurnal activity, aggression, anxiety, serotonin release, respiratory reaction to temperature and leptin response. Natural variants affect B. pertussis induced vasoactive amine sensitization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Hrh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Hrh1 APN 6 114480322 missense probably damaging 0.99
IGL01372:Hrh1 APN 6 114479997 missense probably damaging 1.00
IGL01453:Hrh1 APN 6 114481162 missense probably damaging 1.00
IGL01519:Hrh1 APN 6 114480301 missense probably damaging 1.00
IGL02142:Hrh1 APN 6 114480243 missense probably damaging 1.00
IGL02352:Hrh1 APN 6 114480443 missense probably benign 0.43
IGL02359:Hrh1 APN 6 114480443 missense probably benign 0.43
FR4737:Hrh1 UTSW 6 114481123 missense possibly damaging 0.95
R0335:Hrh1 UTSW 6 114480232 missense probably damaging 1.00
R0635:Hrh1 UTSW 6 114480145 missense probably damaging 1.00
R1493:Hrh1 UTSW 6 114480877 missense probably damaging 0.98
R2283:Hrh1 UTSW 6 114480439 missense probably benign 0.00
R3870:Hrh1 UTSW 6 114480919 missense probably damaging 1.00
R4124:Hrh1 UTSW 6 114480619 missense probably benign 0.06
R4254:Hrh1 UTSW 6 114480001 missense probably damaging 1.00
R5270:Hrh1 UTSW 6 114481218 missense possibly damaging 0.75
R6189:Hrh1 UTSW 6 114479998 missense probably damaging 1.00
R6482:Hrh1 UTSW 6 114480763 missense possibly damaging 0.93
R7495:Hrh1 UTSW 6 114480673 missense probably benign 0.05
R7683:Hrh1 UTSW 6 114479787 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGATCATGACCGCCATC -3'
(R):5'- TGGTCATTGGCCTTTGAGCC -3'

Sequencing Primer
(F):5'- GATCATGACCGCCATCATCAACTTC -3'
(R):5'- ATTGGCCTTTGAGCCCCTGG -3'
Posted On2015-11-11