Incidental Mutation 'R4764:Gm5592'
ID 357096
Institutional Source Beutler Lab
Gene Symbol Gm5592
Ensembl Gene ENSMUSG00000072259
Gene Name predicted gene 5592
Synonyms
MMRRC Submission 042405-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R4764 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 40933751-40939607 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) G to T at 40865542 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000206490]
AlphaFold Q3V0A6
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206040
Predicted Effect probably benign
Transcript: ENSMUST00000206490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206653
Meta Mutation Damage Score 0.1413 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,122,029 (GRCm39) S18R probably benign Het
2010315B03Rik A C 9: 124,056,396 (GRCm39) V176G probably benign Het
Abcb1a T A 5: 8,765,732 (GRCm39) probably null Het
Acad11 C A 9: 103,953,076 (GRCm39) P102T probably damaging Het
Aggf1 T A 13: 95,501,221 (GRCm39) D387V probably damaging Het
Akr1c13 G A 13: 4,248,496 (GRCm39) V234I probably benign Het
Alg5 A G 3: 54,653,894 (GRCm39) Y210C possibly damaging Het
Arl8a C A 1: 135,074,837 (GRCm39) A41E probably benign Het
Axin1 C A 17: 26,392,730 (GRCm39) T337K possibly damaging Het
Bdp1 A G 13: 100,192,775 (GRCm39) L1353P probably damaging Het
Bptf A T 11: 106,934,520 (GRCm39) V2851E probably damaging Het
C9 A T 15: 6,489,124 (GRCm39) E160D probably damaging Het
Cbx6 T C 15: 79,712,881 (GRCm39) D182G probably damaging Het
Cep57l1 T C 10: 41,597,678 (GRCm39) R242G possibly damaging Het
Chst8 T C 7: 34,375,149 (GRCm39) D230G probably damaging Het
Col3a1 A C 1: 45,385,270 (GRCm39) D129A probably damaging Het
Cst12 A G 2: 148,631,393 (GRCm39) E38G possibly damaging Het
Disp1 G T 1: 182,869,660 (GRCm39) A920E probably damaging Het
Dtna T G 18: 23,668,206 (GRCm39) probably null Het
Elp3 T A 14: 65,820,378 (GRCm39) H97L probably damaging Het
Exoc8 A G 8: 125,624,314 (GRCm39) F18L possibly damaging Het
Extl3 T C 14: 65,314,769 (GRCm39) T138A probably benign Het
Foxi2 G T 7: 135,012,396 (GRCm39) G95C probably damaging Het
Foxj2 G T 6: 122,810,230 (GRCm39) Q196H probably benign Het
Frem1 A T 4: 82,907,426 (GRCm39) D811E probably damaging Het
Frmd4a A T 2: 4,608,259 (GRCm39) E709V probably damaging Het
Fscn3 T A 6: 28,436,200 (GRCm39) *499K probably null Het
Galc C T 12: 98,209,003 (GRCm39) G217D possibly damaging Het
Gm57858 T G 3: 36,064,809 (GRCm39) *521C probably null Het
Hnrnpul1 A G 7: 25,442,436 (GRCm39) S269P probably benign Het
Hrh1 T C 6: 114,457,496 (GRCm39) V259A probably benign Het
Lef1 T C 3: 130,978,382 (GRCm39) S167P probably benign Het
Mtf2 T C 5: 108,241,218 (GRCm39) I248T probably benign Het
Muc2 C T 7: 141,299,345 (GRCm39) T130M possibly damaging Het
Myo16 T C 8: 10,485,880 (GRCm39) F653S probably damaging Het
Myo1e T C 9: 70,250,417 (GRCm39) probably null Het
Myo5a G T 9: 75,023,618 (GRCm39) probably benign Het
Nlrp1b T A 11: 71,073,489 (GRCm39) D118V probably damaging Het
Npat T C 9: 53,483,920 (GRCm39) F1412S probably damaging Het
Onecut3 G T 10: 80,331,541 (GRCm39) A234S unknown Het
Or1ad1 G A 11: 50,875,602 (GRCm39) E25K probably benign Het
Or8b37 T G 9: 37,959,436 (GRCm39) L306R probably benign Het
Osbpl6 T A 2: 76,376,344 (GRCm39) I73K probably damaging Het
Otog C T 7: 45,937,943 (GRCm39) T1884I probably benign Het
Pax6 C A 2: 105,526,847 (GRCm39) P251Q probably benign Het
Pias4 A G 10: 80,999,868 (GRCm39) Y62H possibly damaging Het
Pknox1 T A 17: 31,809,687 (GRCm39) V97D possibly damaging Het
Plekhf1 A G 7: 37,921,022 (GRCm39) V182A probably damaging Het
Plscr4 T C 9: 92,366,833 (GRCm39) V149A probably damaging Het
Polr2l A T 7: 141,053,309 (GRCm39) L35Q probably damaging Het
Ppp3ca T C 3: 136,596,250 (GRCm39) I305T probably damaging Het
Ptprg G A 14: 12,122,068 (GRCm38) A311T probably benign Het
Raet1e T G 10: 22,057,231 (GRCm39) I185R probably damaging Het
Rims1 A C 1: 22,518,543 (GRCm39) V520G probably damaging Het
Rp1 A T 1: 4,416,101 (GRCm39) D1670E probably damaging Het
Rps6ka1 A T 4: 133,587,868 (GRCm39) I352N probably damaging Het
Rtp3 T C 9: 110,816,418 (GRCm39) probably benign Het
Ryr3 T A 2: 112,563,376 (GRCm39) probably null Het
Sall3 A G 18: 81,017,691 (GRCm39) V79A probably damaging Het
Sdsl C T 5: 120,600,119 (GRCm39) V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 (GRCm39) N197D probably benign Het
Slit1 T A 19: 41,709,483 (GRCm39) R137* probably null Het
Stxbp5 C A 10: 9,646,367 (GRCm39) R115L probably damaging Het
Tcea1 G A 1: 4,965,167 (GRCm39) R290H probably damaging Het
Tmem132e A T 11: 82,325,338 (GRCm39) T113S probably damaging Het
Tpp1 A T 7: 105,398,458 (GRCm39) I286N probably damaging Het
Trio G A 15: 27,732,624 (GRCm39) R3086* probably null Het
Usp22 T A 11: 61,051,462 (GRCm39) N294Y probably damaging Het
Usp44 T A 10: 93,681,933 (GRCm39) S128T probably benign Het
Zc3h7b T C 15: 81,653,384 (GRCm39) probably null Het
Zfhx2 T C 14: 55,304,372 (GRCm39) Y1204C possibly damaging Het
Other mutations in Gm5592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Gm5592 APN 7 40,938,519 (GRCm39) missense probably damaging 1.00
IGL01472:Gm5592 APN 7 40,935,498 (GRCm39) splice site probably benign
IGL01718:Gm5592 APN 7 40,938,617 (GRCm39) missense probably damaging 0.99
IGL01981:Gm5592 APN 7 40,935,795 (GRCm39) nonsense probably null
IGL02318:Gm5592 APN 7 40,936,212 (GRCm39) missense probably benign 0.37
IGL02346:Gm5592 APN 7 40,938,889 (GRCm39) missense probably damaging 0.97
IGL02904:Gm5592 APN 7 40,937,810 (GRCm39) missense probably damaging 1.00
I1329:Gm5592 UTSW 7 40,935,778 (GRCm39) nonsense probably null
R0465:Gm5592 UTSW 7 40,805,481 (GRCm39) intron probably benign
R0669:Gm5592 UTSW 7 40,805,254 (GRCm39) intron probably benign
R0675:Gm5592 UTSW 7 40,938,811 (GRCm39) missense possibly damaging 0.81
R1381:Gm5592 UTSW 7 40,935,596 (GRCm39) missense probably benign
R1731:Gm5592 UTSW 7 40,937,837 (GRCm39) missense probably damaging 0.99
R3149:Gm5592 UTSW 7 40,937,804 (GRCm39) missense probably benign 0.00
R3150:Gm5592 UTSW 7 40,937,804 (GRCm39) missense probably benign 0.00
R3176:Gm5592 UTSW 7 40,937,804 (GRCm39) missense probably benign 0.00
R3177:Gm5592 UTSW 7 40,937,804 (GRCm39) missense probably benign 0.00
R3276:Gm5592 UTSW 7 40,937,804 (GRCm39) missense probably benign 0.00
R3277:Gm5592 UTSW 7 40,937,804 (GRCm39) missense probably benign 0.00
R3623:Gm5592 UTSW 7 40,807,052 (GRCm39) intron probably benign
R3797:Gm5592 UTSW 7 40,807,259 (GRCm39) intron probably benign
R3854:Gm5592 UTSW 7 40,807,259 (GRCm39) intron probably benign
R3856:Gm5592 UTSW 7 40,807,259 (GRCm39) intron probably benign
R4009:Gm5592 UTSW 7 40,938,934 (GRCm39) missense probably benign 0.01
R4010:Gm5592 UTSW 7 40,936,052 (GRCm39) missense probably benign 0.05
R4011:Gm5592 UTSW 7 40,938,934 (GRCm39) missense probably benign 0.01
R4127:Gm5592 UTSW 7 40,938,491 (GRCm39) missense probably benign 0.00
R4162:Gm5592 UTSW 7 40,867,202 (GRCm39) intron probably benign
R4289:Gm5592 UTSW 7 40,808,336 (GRCm39) intron probably benign
R4304:Gm5592 UTSW 7 40,935,686 (GRCm39) missense probably benign 0.20
R4332:Gm5592 UTSW 7 40,865,542 (GRCm39) intron probably benign
R4408:Gm5592 UTSW 7 40,935,872 (GRCm39) missense probably benign 0.04
R4572:Gm5592 UTSW 7 40,865,583 (GRCm39) intron probably benign
R4822:Gm5592 UTSW 7 40,805,314 (GRCm39) intron probably benign
R4836:Gm5592 UTSW 7 40,864,958 (GRCm39) intron probably benign
R4854:Gm5592 UTSW 7 40,866,895 (GRCm39) intron probably benign
R5032:Gm5592 UTSW 7 40,939,159 (GRCm39) missense probably damaging 1.00
R5075:Gm5592 UTSW 7 40,808,387 (GRCm39) intron probably benign
R5369:Gm5592 UTSW 7 40,867,635 (GRCm39) intron probably benign
R5424:Gm5592 UTSW 7 40,805,017 (GRCm39) intron probably benign
R5700:Gm5592 UTSW 7 40,808,003 (GRCm39) intron probably benign
R5741:Gm5592 UTSW 7 40,938,625 (GRCm39) missense probably benign
R5802:Gm5592 UTSW 7 40,868,529 (GRCm39) intron probably benign
R5945:Gm5592 UTSW 7 40,865,036 (GRCm39) intron probably benign
R6117:Gm5592 UTSW 7 40,937,888 (GRCm39) missense probably benign 0.00
R6324:Gm5592 UTSW 7 40,935,959 (GRCm39) missense probably damaging 0.98
R6449:Gm5592 UTSW 7 40,938,010 (GRCm39) missense probably benign 0.09
R6571:Gm5592 UTSW 7 40,937,999 (GRCm39) missense probably damaging 0.98
R6776:Gm5592 UTSW 7 40,939,153 (GRCm39) missense probably damaging 1.00
R7595:Gm5592 UTSW 7 40,935,867 (GRCm39) missense probably damaging 0.99
R7658:Gm5592 UTSW 7 40,938,134 (GRCm39) missense probably benign 0.03
R7699:Gm5592 UTSW 7 40,935,831 (GRCm39) missense probably damaging 1.00
R7700:Gm5592 UTSW 7 40,935,831 (GRCm39) missense probably damaging 1.00
R7774:Gm5592 UTSW 7 40,939,283 (GRCm39) missense probably damaging 1.00
R7788:Gm5592 UTSW 7 40,936,118 (GRCm39) missense probably benign 0.01
R7890:Gm5592 UTSW 7 40,936,183 (GRCm39) missense probably damaging 1.00
R8070:Gm5592 UTSW 7 40,935,887 (GRCm39) missense possibly damaging 0.76
R8417:Gm5592 UTSW 7 40,937,975 (GRCm39) missense probably benign 0.38
R8866:Gm5592 UTSW 7 40,938,246 (GRCm39) missense possibly damaging 0.74
R9044:Gm5592 UTSW 7 40,938,274 (GRCm39) missense probably benign 0.25
R9057:Gm5592 UTSW 7 40,938,887 (GRCm39) missense possibly damaging 0.93
R9258:Gm5592 UTSW 7 40,938,407 (GRCm39) missense possibly damaging 0.56
R9451:Gm5592 UTSW 7 40,935,876 (GRCm39) missense probably damaging 0.99
R9760:Gm5592 UTSW 7 40,939,234 (GRCm39) missense possibly damaging 0.57
X0021:Gm5592 UTSW 7 40,937,932 (GRCm39) missense probably benign 0.01
Z1176:Gm5592 UTSW 7 40,938,105 (GRCm39) missense probably benign 0.00
Z1176:Gm5592 UTSW 7 40,935,743 (GRCm39) missense possibly damaging 0.94
Z1176:Gm5592 UTSW 7 40,935,741 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTTTTGTCCAAGTTACACC -3'
(R):5'- CTCTGGCTGTGTGGAATATCC -3'

Sequencing Primer
(F):5'- GTTTTGTCCAAGTTACACCACCACAG -3'
(R):5'- AAGTAGACTTGAGCATCCTTGG -3'
Posted On 2015-11-11