Incidental Mutation 'R0403:Prss35'
ID 35710
Institutional Source Beutler Lab
Gene Symbol Prss35
Ensembl Gene ENSMUSG00000033491
Gene Name serine protease 35
Synonyms 6030424L22Rik
MMRRC Submission 038608-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R0403 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 86625702-86640496 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86638090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 287 (M287V)
Ref Sequence ENSEMBL: ENSMUSP00000137445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036426] [ENSMUST00000179574]
AlphaFold Q8C0F9
Predicted Effect probably damaging
Transcript: ENSMUST00000036426
AA Change: M287V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035271
Gene: ENSMUSG00000033491
AA Change: M287V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179574
AA Change: M287V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137445
Gene: ENSMUSG00000033491
AA Change: M287V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
Tryp_SPc 132 399 4.13e-2 SMART
Meta Mutation Damage Score 0.5207 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,864,706 (GRCm39) probably null Het
Adgrg3 C T 8: 95,763,550 (GRCm39) L284F probably benign Het
Alkbh8 T A 9: 3,385,469 (GRCm39) V587E probably damaging Het
Ap4b1 T A 3: 103,728,712 (GRCm39) M590K probably benign Het
Ap4b1 T A 3: 103,726,155 (GRCm39) C244S probably damaging Het
Arhgap15 C T 2: 43,953,778 (GRCm39) T168I probably damaging Het
Atp8b1 A G 18: 64,673,381 (GRCm39) V997A probably damaging Het
Atrn G A 2: 130,748,779 (GRCm39) C100Y probably damaging Het
Baiap2l2 C A 15: 79,155,416 (GRCm39) A151S probably benign Het
Baz2b A T 2: 59,799,721 (GRCm39) D199E possibly damaging Het
Bmal2 T A 6: 146,724,153 (GRCm39) H348Q probably damaging Het
Cblb A G 16: 51,972,989 (GRCm39) D440G probably benign Het
Cdon T C 9: 35,384,796 (GRCm39) V694A probably benign Het
Cep250 A T 2: 155,834,269 (GRCm39) R2065W probably damaging Het
Ces2b G T 8: 105,560,577 (GRCm39) A131S probably damaging Het
Chrna9 A T 5: 66,125,235 (GRCm39) T59S possibly damaging Het
Cog3 T A 14: 75,979,767 (GRCm39) probably benign Het
Cpa1 G A 6: 30,641,856 (GRCm39) V227I probably benign Het
Cyp3a25 A T 5: 145,935,323 (GRCm39) C98S probably damaging Het
D8Ertd738e C T 8: 84,976,230 (GRCm39) probably null Het
Ddx60 A G 8: 62,447,575 (GRCm39) probably benign Het
Dhx16 T C 17: 36,193,942 (GRCm39) probably null Het
Dnah9 T A 11: 65,975,615 (GRCm39) Q1478L possibly damaging Het
Dock10 T C 1: 80,501,787 (GRCm39) Y1434C possibly damaging Het
Enpp3 T A 10: 24,680,334 (GRCm39) D325V probably damaging Het
Entpd6 C A 2: 150,602,090 (GRCm39) T194K possibly damaging Het
Fat2 A T 11: 55,161,175 (GRCm39) V3185E probably benign Het
Flrt1 A G 19: 7,073,284 (GRCm39) L421P probably benign Het
Fmn2 A T 1: 174,521,844 (GRCm39) Q1292L probably damaging Het
Fndc1 T C 17: 7,972,555 (GRCm39) D1459G probably damaging Het
Fndc1 T C 17: 7,994,420 (GRCm39) probably null Het
Fzr1 A G 10: 81,205,202 (GRCm39) S265P possibly damaging Het
Gpr142 G A 11: 114,696,855 (GRCm39) V134M probably damaging Het
Grid2ip G T 5: 143,343,375 (GRCm39) V24L possibly damaging Het
Herc2 G A 7: 55,809,165 (GRCm39) R2555H probably damaging Het
Hpdl A T 4: 116,677,676 (GRCm39) Y262N possibly damaging Het
Htr3a A G 9: 48,819,959 (GRCm39) V57A probably damaging Het
Igfbp7 T C 5: 77,503,438 (GRCm39) I186V probably benign Het
Itga2b C T 11: 102,358,152 (GRCm39) probably null Het
Itgae A C 11: 73,014,009 (GRCm39) D736A possibly damaging Het
Itpkc T A 7: 26,907,770 (GRCm39) M645L probably benign Het
Jchain T C 5: 88,669,237 (GRCm39) R139G probably benign Het
Kif13a A G 13: 46,944,877 (GRCm39) V908A probably damaging Het
Kif1b T A 4: 149,266,424 (GRCm39) K389* probably null Het
Klhl12 T C 1: 134,413,594 (GRCm39) Y360H possibly damaging Het
Knop1 G A 7: 118,452,276 (GRCm39) R148W probably damaging Het
Lpar1 T A 4: 58,487,191 (GRCm39) N27Y probably damaging Het
Lpar2 T A 8: 70,276,802 (GRCm39) V197D probably damaging Het
Lrrc74a A G 12: 86,787,753 (GRCm39) N128S probably damaging Het
Lum G T 10: 97,407,905 (GRCm39) V337F probably benign Het
Mag T C 7: 30,606,405 (GRCm39) D344G probably damaging Het
Maip1 G A 1: 57,446,355 (GRCm39) A142T probably benign Het
Mlh3 A G 12: 85,315,742 (GRCm39) V148A possibly damaging Het
Nav3 A G 10: 109,602,964 (GRCm39) V1195A probably damaging Het
Ncor2 A G 5: 125,110,401 (GRCm39) S868P possibly damaging Het
Nek1 A G 8: 61,559,889 (GRCm39) E907G probably damaging Het
Nfam1 G A 15: 82,900,580 (GRCm39) T134I probably benign Het
Nr0b2 T C 4: 133,281,070 (GRCm39) V112A probably damaging Het
Nrp1 A G 8: 129,184,450 (GRCm39) N365S probably damaging Het
Nrsn2 T C 2: 152,211,710 (GRCm39) Y107C probably damaging Het
Ntng1 G A 3: 109,841,927 (GRCm39) A282V probably damaging Het
Nxf1 T C 19: 8,742,392 (GRCm39) I337T probably damaging Het
Obscn C T 11: 58,967,366 (GRCm39) G479D probably damaging Het
Oprd1 T A 4: 131,841,079 (GRCm39) D293V probably benign Het
Or13a17 T C 7: 140,271,222 (GRCm39) S135P possibly damaging Het
P3h2 T G 16: 25,788,700 (GRCm39) N586H possibly damaging Het
Pcid2 T C 8: 13,135,367 (GRCm39) Y214C probably damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Pkd1l3 G A 8: 110,350,295 (GRCm39) S380N probably benign Het
Ppic C A 18: 53,544,143 (GRCm39) G81W probably damaging Het
Ppp2r1a C A 17: 21,177,303 (GRCm39) P246T probably damaging Het
Ppp4r4 T G 12: 103,550,361 (GRCm39) S46A probably benign Het
Pramel31 A G 4: 144,089,216 (GRCm39) N178S probably benign Het
Prkce A G 17: 86,476,081 (GRCm39) T21A probably damaging Het
Prkg2 T C 5: 99,142,504 (GRCm39) E210G possibly damaging Het
Psd G A 19: 46,309,411 (GRCm39) probably benign Het
Ptch2 A T 4: 116,968,036 (GRCm39) K843* probably null Het
Rab44 C A 17: 29,364,235 (GRCm39) T603K probably damaging Het
Rasal3 T A 17: 32,611,764 (GRCm39) probably null Het
Rbbp6 A G 7: 122,591,519 (GRCm39) T526A probably damaging Het
Ros1 A T 10: 52,019,534 (GRCm39) probably benign Het
Sec24b T A 3: 129,783,325 (GRCm39) L1104F possibly damaging Het
Sec24b A G 3: 129,793,183 (GRCm39) S685P probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Setmar A T 6: 108,052,923 (GRCm39) H139L probably benign Het
Slc28a2b T C 2: 122,352,335 (GRCm39) L364S probably damaging Het
Slc4a7 T C 14: 14,766,808 (GRCm38) V710A probably benign Het
Smarcc1 T A 9: 110,066,876 (GRCm39) probably null Het
Smchd1 G A 17: 71,701,897 (GRCm39) L1032F probably damaging Het
Speg T C 1: 75,407,428 (GRCm39) probably benign Het
Tasor2 A T 13: 3,632,052 (GRCm39) Y816* probably null Het
Tcea1 C G 1: 4,959,726 (GRCm39) R134G probably benign Het
Tchhl1 C T 3: 93,378,336 (GRCm39) Q347* probably null Het
Tecrl A T 5: 83,502,605 (GRCm39) probably benign Het
Tepsin T C 11: 119,984,508 (GRCm39) probably benign Het
Tmem40 G A 6: 115,710,946 (GRCm39) probably benign Het
Tpr G A 1: 150,283,165 (GRCm39) probably benign Het
Ttll12 A T 15: 83,464,859 (GRCm39) probably benign Het
Ttn T A 2: 76,739,952 (GRCm39) D3529V probably benign Het
Usp34 T A 11: 23,283,838 (GRCm39) H177Q possibly damaging Het
Vsig10 T A 5: 117,476,526 (GRCm39) S327T probably benign Het
Zbtb4 T A 11: 69,668,465 (GRCm39) M396K probably damaging Het
Zfp352 C T 4: 90,113,246 (GRCm39) T462I possibly damaging Het
Zfp385b T C 2: 77,307,189 (GRCm39) M145V probably damaging Het
Zfp780b C A 7: 27,671,114 (GRCm39) V65F possibly damaging Het
Other mutations in Prss35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Prss35 APN 9 86,637,327 (GRCm39) missense probably benign 0.00
IGL02749:Prss35 APN 9 86,638,297 (GRCm39) missense probably damaging 1.00
R0346:Prss35 UTSW 9 86,637,404 (GRCm39) missense probably benign 0.04
R1664:Prss35 UTSW 9 86,637,700 (GRCm39) missense probably benign 0.29
R2016:Prss35 UTSW 9 86,637,565 (GRCm39) missense probably benign 0.37
R2017:Prss35 UTSW 9 86,637,565 (GRCm39) missense probably benign 0.37
R2325:Prss35 UTSW 9 86,638,357 (GRCm39) missense probably damaging 1.00
R2429:Prss35 UTSW 9 86,637,398 (GRCm39) missense probably benign
R2965:Prss35 UTSW 9 86,637,635 (GRCm39) missense probably damaging 1.00
R2966:Prss35 UTSW 9 86,637,635 (GRCm39) missense probably damaging 1.00
R3961:Prss35 UTSW 9 86,637,802 (GRCm39) missense probably benign 0.02
R4792:Prss35 UTSW 9 86,637,722 (GRCm39) missense probably damaging 1.00
R4902:Prss35 UTSW 9 86,638,175 (GRCm39) missense probably damaging 1.00
R6169:Prss35 UTSW 9 86,637,491 (GRCm39) missense probably benign 0.00
R6446:Prss35 UTSW 9 86,637,706 (GRCm39) missense probably damaging 0.99
R6753:Prss35 UTSW 9 86,638,153 (GRCm39) missense probably damaging 1.00
R7008:Prss35 UTSW 9 86,638,361 (GRCm39) missense probably benign 0.01
R7387:Prss35 UTSW 9 86,637,974 (GRCm39) missense probably damaging 1.00
R7523:Prss35 UTSW 9 86,637,427 (GRCm39) missense probably damaging 1.00
R7587:Prss35 UTSW 9 86,637,427 (GRCm39) missense probably damaging 1.00
R7652:Prss35 UTSW 9 86,638,023 (GRCm39) missense probably benign
R8013:Prss35 UTSW 9 86,637,478 (GRCm39) missense probably damaging 1.00
R8194:Prss35 UTSW 9 86,637,666 (GRCm39) missense possibly damaging 0.94
R8871:Prss35 UTSW 9 86,637,244 (GRCm39) missense possibly damaging 0.84
R9444:Prss35 UTSW 9 86,638,157 (GRCm39) missense probably damaging 1.00
R9462:Prss35 UTSW 9 86,638,392 (GRCm39) missense
R9695:Prss35 UTSW 9 86,637,761 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCAAGAAACGCAGAGGTTCC -3'
(R):5'- TGCCTCAGCATCGCAATACTGATAC -3'

Sequencing Primer
(F):5'- GTCAAAGTCAGGCGCATCTTC -3'
(R):5'- TCGCAATACTGATACAGGAGGTC -3'
Posted On 2013-05-09