Incidental Mutation 'R0403:Smarcc1'
ID35711
Institutional Source Beutler Lab
Gene Symbol Smarcc1
Ensembl Gene ENSMUSG00000032481
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
SynonymsBAF155, SRG3
MMRRC Submission 038608-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0403 (G1)
Quality Score195
Status Validated
Chromosome9
Chromosomal Location110117708-110240178 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 110237808 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088716] [ENSMUST00000088716] [ENSMUST00000088716] [ENSMUST00000197984] [ENSMUST00000199896] [ENSMUST00000199896] [ENSMUST00000199896]
Predicted Effect probably null
Transcript: ENSMUST00000088716
SMART Domains Protein: ENSMUSP00000086094
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.7e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 9.6e-35 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 2.5e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
low complexity region 1075 1104 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088716
SMART Domains Protein: ENSMUSP00000086094
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.7e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 9.6e-35 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 2.5e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
low complexity region 1075 1104 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000088716
SMART Domains Protein: ENSMUSP00000086094
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.7e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 9.6e-35 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 2.5e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
low complexity region 1075 1104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197984
SMART Domains Protein: ENSMUSP00000142611
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 448 536 1.4e-35 PFAM
SANT 618 666 4.52e-12 SMART
low complexity region 710 717 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 768 781 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 866 885 N/A INTRINSIC
coiled coil region 909 945 N/A INTRINSIC
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198211
Predicted Effect probably null
Transcript: ENSMUST00000199896
SMART Domains Protein: ENSMUSP00000143550
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.5e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 1.4e-34 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 1.4e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199896
SMART Domains Protein: ENSMUSP00000143550
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.5e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 1.4e-34 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 1.4e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199896
SMART Domains Protein: ENSMUSP00000143550
Gene: ENSMUSG00000032481

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
CHROMO 214 260 3.06e-3 SMART
low complexity region 321 333 N/A INTRINSIC
Pfam:SWIRM 450 536 1.5e-33 PFAM
SANT 618 666 4.52e-12 SMART
Pfam:SWIRM-assoc_3 705 771 1.4e-34 PFAM
low complexity region 830 839 N/A INTRINSIC
Pfam:SWIRM-assoc_1 870 953 1.4e-34 PFAM
low complexity region 955 973 N/A INTRINSIC
low complexity region 986 1031 N/A INTRINSIC
low complexity region 1043 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200426
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out mutation display early embryonic lethality soon after decidualization due to failed egg cylinder formation and defects in the inner cell mass and primitive endoderm. About 20% of heterozygous mutant embryos show exencephaly caused by failure in neural fold elevation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,973,880 probably null Het
Adgrg3 C T 8: 95,036,922 L284F probably benign Het
Alkbh8 T A 9: 3,385,469 V587E probably damaging Het
Ap4b1 T A 3: 103,818,839 C244S probably damaging Het
Ap4b1 T A 3: 103,821,396 M590K probably benign Het
Arhgap15 C T 2: 44,063,766 T168I probably damaging Het
Arntl2 T A 6: 146,822,655 H348Q probably damaging Het
Atp8b1 A G 18: 64,540,310 V997A probably damaging Het
Atrn G A 2: 130,906,859 C100Y probably damaging Het
Baiap2l2 C A 15: 79,271,216 A151S probably benign Het
Baz2b A T 2: 59,969,377 D199E possibly damaging Het
Cblb A G 16: 52,152,626 D440G probably benign Het
Cdon T C 9: 35,473,500 V694A probably benign Het
Cep250 A T 2: 155,992,349 R2065W probably damaging Het
Ces2b G T 8: 104,833,945 A131S probably damaging Het
Chrna9 A T 5: 65,967,892 T59S possibly damaging Het
Cog3 T A 14: 75,742,327 probably benign Het
Cpa1 G A 6: 30,641,857 V227I probably benign Het
Cyp3a25 A T 5: 145,998,513 C98S probably damaging Het
D8Ertd738e C T 8: 84,249,601 probably null Het
Ddx60 A G 8: 61,994,541 probably benign Het
Dhx16 T C 17: 35,883,050 probably null Het
Dnah9 T A 11: 66,084,789 Q1478L possibly damaging Het
Dock10 T C 1: 80,524,070 Y1434C possibly damaging Het
Enpp3 T A 10: 24,804,436 D325V probably damaging Het
Entpd6 C A 2: 150,760,170 T194K possibly damaging Het
Fam208b A T 13: 3,582,052 Y816* probably null Het
Fat2 A T 11: 55,270,349 V3185E probably benign Het
Flrt1 A G 19: 7,095,919 L421P probably benign Het
Fmn2 A T 1: 174,694,278 Q1292L probably damaging Het
Fndc1 T C 17: 7,775,588 probably null Het
Fndc1 T C 17: 7,753,723 D1459G probably damaging Het
Fzr1 A G 10: 81,369,368 S265P possibly damaging Het
Gm13119 A G 4: 144,362,646 N178S probably benign Het
Gm14085 T C 2: 122,521,854 L364S probably damaging Het
Gpr142 G A 11: 114,806,029 V134M probably damaging Het
Grid2ip G T 5: 143,357,620 V24L possibly damaging Het
Herc2 G A 7: 56,159,417 R2555H probably damaging Het
Hpdl A T 4: 116,820,479 Y262N possibly damaging Het
Htr3a A G 9: 48,908,659 V57A probably damaging Het
Igfbp7 T C 5: 77,355,591 I186V probably benign Het
Itga2b C T 11: 102,467,326 probably null Het
Itgae A C 11: 73,123,183 D736A possibly damaging Het
Itpkc T A 7: 27,208,345 M645L probably benign Het
Jchain T C 5: 88,521,378 R139G probably benign Het
Kif13a A G 13: 46,791,401 V908A probably damaging Het
Kif1b T A 4: 149,181,967 K389* probably null Het
Klhl12 T C 1: 134,485,856 Y360H possibly damaging Het
Knop1 G A 7: 118,853,053 R148W probably damaging Het
Lpar1 T A 4: 58,487,191 N27Y probably damaging Het
Lpar2 T A 8: 69,824,152 V197D probably damaging Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Lum G T 10: 97,572,043 V337F probably benign Het
Mag T C 7: 30,906,980 D344G probably damaging Het
Maip1 G A 1: 57,407,196 A142T probably benign Het
Mlh3 A G 12: 85,268,968 V148A possibly damaging Het
Nav3 A G 10: 109,767,103 V1195A probably damaging Het
Ncor2 A G 5: 125,033,337 S868P possibly damaging Het
Nek1 A G 8: 61,106,855 E907G probably damaging Het
Nfam1 G A 15: 83,016,379 T134I probably benign Het
Nr0b2 T C 4: 133,553,759 V112A probably damaging Het
Nrp1 A G 8: 128,457,969 N365S probably damaging Het
Nrsn2 T C 2: 152,369,790 Y107C probably damaging Het
Ntng1 G A 3: 109,934,611 A282V probably damaging Het
Nxf1 T C 19: 8,765,028 I337T probably damaging Het
Obscn C T 11: 59,076,540 G479D probably damaging Het
Olfr45 T C 7: 140,691,309 S135P possibly damaging Het
Oprd1 T A 4: 132,113,768 D293V probably benign Het
P3h2 T G 16: 25,969,950 N586H possibly damaging Het
Pcid2 T C 8: 13,085,367 Y214C probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Ppic C A 18: 53,411,071 G81W probably damaging Het
Ppp2r1a C A 17: 20,957,041 P246T probably damaging Het
Ppp4r4 T G 12: 103,584,102 S46A probably benign Het
Prkce A G 17: 86,168,653 T21A probably damaging Het
Prkg2 T C 5: 98,994,645 E210G possibly damaging Het
Prss35 A G 9: 86,756,037 M287V probably damaging Het
Psd G A 19: 46,320,972 probably benign Het
Ptch2 A T 4: 117,110,839 K843* probably null Het
Rab44 C A 17: 29,145,261 T603K probably damaging Het
Rasal3 T A 17: 32,392,790 probably null Het
Rbbp6 A G 7: 122,992,296 T526A probably damaging Het
Ros1 A T 10: 52,143,438 probably benign Het
Sec24b T A 3: 129,989,676 L1104F possibly damaging Het
Sec24b A G 3: 129,999,534 S685P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setmar A T 6: 108,075,962 H139L probably benign Het
Slc4a7 T C 14: 14,766,808 V710A probably benign Het
Smchd1 G A 17: 71,394,902 L1032F probably damaging Het
Speg T C 1: 75,430,784 probably benign Het
Tcea1 C G 1: 4,889,503 R134G probably benign Het
Tchhl1 C T 3: 93,471,029 Q347* probably null Het
Tecrl A T 5: 83,354,758 probably benign Het
Tepsin T C 11: 120,093,682 probably benign Het
Tmem40 G A 6: 115,733,985 probably benign Het
Tpr G A 1: 150,407,414 probably benign Het
Ttll12 A T 15: 83,580,658 probably benign Het
Ttn T A 2: 76,909,608 D3529V probably benign Het
Usp34 T A 11: 23,333,838 H177Q possibly damaging Het
Vsig10 T A 5: 117,338,461 S327T probably benign Het
Zbtb4 T A 11: 69,777,639 M396K probably damaging Het
Zfp352 C T 4: 90,225,009 T462I possibly damaging Het
Zfp385b T C 2: 77,476,845 M145V probably damaging Het
Zfp780b C A 7: 27,971,689 V65F possibly damaging Het
Other mutations in Smarcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Smarcc1 APN 9 110221937 missense probably damaging 1.00
IGL01152:Smarcc1 APN 9 110139625 missense possibly damaging 0.89
IGL01353:Smarcc1 APN 9 110135666 missense probably benign 0.07
IGL01401:Smarcc1 APN 9 110149965 missense possibly damaging 0.52
IGL01483:Smarcc1 APN 9 110222060 nonsense probably null
IGL01679:Smarcc1 APN 9 110213530 missense probably damaging 1.00
IGL02458:Smarcc1 APN 9 110132126 intron probably benign
IGL02498:Smarcc1 APN 9 110190934 missense probably damaging 1.00
IGL02605:Smarcc1 APN 9 110222000 missense possibly damaging 0.86
IGL03003:Smarcc1 APN 9 110206100 missense probably damaging 0.97
IGL03284:Smarcc1 APN 9 110175074 missense probably benign 0.30
R0116:Smarcc1 UTSW 9 110147104 missense possibly damaging 0.71
R1436:Smarcc1 UTSW 9 110118640 unclassified probably benign
R1583:Smarcc1 UTSW 9 110213617 missense probably damaging 1.00
R1692:Smarcc1 UTSW 9 110174004 missense possibly damaging 0.85
R1732:Smarcc1 UTSW 9 110185820 splice site probably benign
R1833:Smarcc1 UTSW 9 110153811 missense possibly damaging 0.71
R1881:Smarcc1 UTSW 9 110175099 missense probably damaging 1.00
R2058:Smarcc1 UTSW 9 110118343 unclassified probably benign
R2175:Smarcc1 UTSW 9 110164809 missense possibly damaging 0.71
R2215:Smarcc1 UTSW 9 110237839 utr 3 prime probably benign
R2904:Smarcc1 UTSW 9 110173975 missense possibly damaging 0.80
R3899:Smarcc1 UTSW 9 110118518 unclassified probably benign
R3900:Smarcc1 UTSW 9 110118518 unclassified probably benign
R4012:Smarcc1 UTSW 9 110132205 missense possibly damaging 0.96
R4091:Smarcc1 UTSW 9 110164829 missense possibly damaging 0.84
R4356:Smarcc1 UTSW 9 110196256 missense probably damaging 0.99
R4881:Smarcc1 UTSW 9 110135628 start gained probably benign
R4993:Smarcc1 UTSW 9 110175061 missense probably damaging 1.00
R5110:Smarcc1 UTSW 9 110197784 missense possibly damaging 0.89
R5375:Smarcc1 UTSW 9 110190949 missense probably damaging 0.99
R5655:Smarcc1 UTSW 9 110157344 missense probably null 1.00
R5715:Smarcc1 UTSW 9 110196367 missense possibly damaging 0.95
R5767:Smarcc1 UTSW 9 110132183 intron probably benign
R5816:Smarcc1 UTSW 9 110197644 missense possibly damaging 0.51
R6969:Smarcc1 UTSW 9 110196320 missense probably damaging 1.00
R7068:Smarcc1 UTSW 9 110185884 missense probably damaging 1.00
R7211:Smarcc1 UTSW 9 110150014 missense probably damaging 0.97
R7558:Smarcc1 UTSW 9 110147116 missense probably damaging 0.96
R7903:Smarcc1 UTSW 9 110204266 missense probably benign 0.01
R7986:Smarcc1 UTSW 9 110204266 missense probably benign 0.01
T0722:Smarcc1 UTSW 9 110206085 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGAGCAACTTCAGCAGCAGTCG -3'
(R):5'- ACAGGCTTCCCAATGAGTGTCAAC -3'

Sequencing Primer
(F):5'- gcataatggctgaggcagg -3'
(R):5'- CTTCCCAATGAGTGTCAACTAAGG -3'
Posted On2013-05-09