Incidental Mutation 'R4764:2010315B03Rik'
ID357111
Institutional Source Beutler Lab
Gene Symbol 2010315B03Rik
Ensembl Gene ENSMUSG00000074829
Gene NameRIKEN cDNA 2010315B03 gene
Synonyms
MMRRC Submission 042405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4764 (G1)
Quality Score121
Status Validated
Chromosome9
Chromosomal Location124291804-124312696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 124293766 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 176 (V176G)
Ref Sequence ENSEMBL: ENSMUSP00000137258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071300] [ENSMUST00000177714] [ENSMUST00000185949] [ENSMUST00000189915]
Predicted Effect probably benign
Transcript: ENSMUST00000071300
AA Change: V197G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000071269
Gene: ENSMUSG00000074829
AA Change: V197G

DomainStartEndE-ValueType
KRAB 24 86 5.28e-14 SMART
ZnF_C2H2 95 117 5.9e-3 SMART
ZnF_C2H2 123 145 1.26e-2 SMART
ZnF_C2H2 151 173 2.95e-3 SMART
ZnF_C2H2 179 201 4.24e-4 SMART
ZnF_C2H2 207 229 1.38e-3 SMART
ZnF_C2H2 235 257 3.21e-4 SMART
ZnF_C2H2 263 285 1.26e-2 SMART
ZnF_C2H2 291 312 6.08e0 SMART
ZnF_C2H2 318 340 8.6e-5 SMART
ZnF_C2H2 346 368 1.36e-2 SMART
ZnF_C2H2 374 396 8.02e-5 SMART
ZnF_C2H2 402 424 9.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177714
AA Change: V176G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000137258
Gene: ENSMUSG00000074829
AA Change: V176G

DomainStartEndE-ValueType
KRAB 28 90 5.28e-14 SMART
ZnF_C2H2 99 121 5.9e-3 SMART
ZnF_C2H2 127 149 1.26e-2 SMART
ZnF_C2H2 155 177 2.95e-3 SMART
ZnF_C2H2 183 205 4.24e-4 SMART
ZnF_C2H2 211 233 1.38e-3 SMART
ZnF_C2H2 239 261 3.21e-4 SMART
ZnF_C2H2 267 289 1.26e-2 SMART
ZnF_C2H2 295 316 6.08e0 SMART
ZnF_C2H2 322 344 8.6e-5 SMART
ZnF_C2H2 350 372 1.36e-2 SMART
ZnF_C2H2 378 400 8.02e-5 SMART
ZnF_C2H2 406 428 9.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185949
SMART Domains Protein: ENSMUSP00000140144
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 29 91 2.3e-16 SMART
ZnF_C2H2 100 122 2.5e-5 SMART
ZnF_C2H2 128 150 5.3e-5 SMART
ZnF_C2H2 156 175 5.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189915
SMART Domains Protein: ENSMUSP00000140738
Gene: ENSMUSG00000074829

DomainStartEndE-ValueType
KRAB 1 63 2.3e-16 SMART
ZnF_C2H2 72 94 2.5e-5 SMART
ZnF_C2H2 100 122 5.3e-5 SMART
ZnF_C2H2 128 150 1.2e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in 2010315B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:2010315B03Rik APN 9 124295490 splice site probably benign
P4748:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0090:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0122:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0140:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0164:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0388:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0775:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R0798:2010315B03Rik UTSW 9 124295159 critical splice acceptor site probably benign
R1467:2010315B03Rik UTSW 9 124295463 missense possibly damaging 0.91
R1569:2010315B03Rik UTSW 9 124293797 nonsense probably null
R2566:2010315B03Rik UTSW 9 124293071 missense probably damaging 0.97
R2566:2010315B03Rik UTSW 9 124293153 missense probably damaging 0.99
R3853:2010315B03Rik UTSW 9 124293346 missense probably damaging 1.00
R4092:2010315B03Rik UTSW 9 124293273 missense probably benign 0.03
R4109:2010315B03Rik UTSW 9 124295103 missense probably benign 0.01
R4646:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4648:2010315B03Rik UTSW 9 124293598 missense probably benign 0.00
R4705:2010315B03Rik UTSW 9 124294001 missense possibly damaging 0.86
R5110:2010315B03Rik UTSW 9 124295357 critical splice donor site probably null
R5117:2010315B03Rik UTSW 9 124293085 missense probably benign 0.00
R5162:2010315B03Rik UTSW 9 124293671 missense probably benign 0.08
R5226:2010315B03Rik UTSW 9 124294076 missense possibly damaging 0.91
R5426:2010315B03Rik UTSW 9 124294003 missense probably damaging 1.00
R6793:2010315B03Rik UTSW 9 124295422 missense possibly damaging 0.85
R6975:2010315B03Rik UTSW 9 124294057 missense probably benign 0.02
R7213:2010315B03Rik UTSW 9 124293900 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATTATTGTGACTTGCAAAGGCTT -3'
(R):5'- CATGGAACTGTCATCTCCGAA -3'

Sequencing Primer
(F):5'- GCTTACGGCATGGAAAGAATTTACC -3'
(R):5'- CTGTCATCTCCGAATCCATAAAAG -3'
Posted On2015-11-11