Incidental Mutation 'R4764:Olfr1377'
ID357118
Institutional Source Beutler Lab
Gene Symbol Olfr1377
Ensembl Gene ENSMUSG00000061952
Gene Nameolfactory receptor 1377
SynonymsMOR129-1, GA_x6K02T2QP88-4453480-4452557
MMRRC Submission 042405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50981967-50986593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50984775 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 25 (E25K)
Ref Sequence ENSEMBL: ENSMUSP00000151087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075177] [ENSMUST00000213291] [ENSMUST00000216101]
Predicted Effect probably benign
Transcript: ENSMUST00000075177
AA Change: E25K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074672
Gene: ENSMUSG00000061952
AA Change: E25K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-51 PFAM
Pfam:7tm_1 41 289 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204581
AA Change: E25K
SMART Domains Protein: ENSMUSP00000144855
Gene: ENSMUSG00000061952
AA Change: E25K

DomainStartEndE-ValueType
Pfam:7tm_4 31 237 5.9e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.9e-4 PFAM
Pfam:7tm_1 41 235 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213291
AA Change: E25K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216101
AA Change: E25K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Galc C T 12: 98,242,744 G217D possibly damaging Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Olfr1377
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1377 APN 11 50985003 missense possibly damaging 0.94
R1386:Olfr1377 UTSW 11 50985367 missense probably damaging 0.97
R1486:Olfr1377 UTSW 11 50984781 missense probably benign 0.00
R1613:Olfr1377 UTSW 11 50985218 missense probably damaging 1.00
R2224:Olfr1377 UTSW 11 50985232 missense probably damaging 1.00
R2411:Olfr1377 UTSW 11 50984931 missense probably damaging 0.98
R3014:Olfr1377 UTSW 11 50984707 missense probably benign 0.00
R4080:Olfr1377 UTSW 11 50984856 missense probably damaging 1.00
R4753:Olfr1377 UTSW 11 50985151 missense probably benign 0.05
R4822:Olfr1377 UTSW 11 50985083 nonsense probably null
R4865:Olfr1377 UTSW 11 50985543 missense probably damaging 0.99
R5053:Olfr1377 UTSW 11 50985310 missense probably damaging 1.00
R6054:Olfr1377 UTSW 11 50984804 missense probably benign 0.00
R6368:Olfr1377 UTSW 11 50984786 missense probably benign 0.00
R7589:Olfr1377 UTSW 11 50985030 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTCCATCAACCAGTAAAGCATTG -3'
(R):5'- TCTGGATCATGCACTCTGTG -3'

Sequencing Primer
(F):5'- TCAACCAGTAAAGCATTGCAAGATAG -3'
(R):5'- AAGAGATGGACTTGCTTCCC -3'
Posted On2015-11-11