Mutagenetix > Incidental Mutation

Incidental Mutation 'R4764:Bptf'

357122

Institutional Source

Beutler Lab

Gene Symbol

Bptf

Ensembl Gene

ENSMUSG00000040481

Gene Name

bromodomain PHD finger transcription factor

Synonyms

9430093H17Rik, Falz

MMRRC Submission

042405-MU

Accession Numbers

Genbank: NM_176850; MGI: 2444008

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4764 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107033081-107132127 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 107043694 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 2851 (V2851E)

Ref Sequence

ENSEMBL: ENSMUSP00000102373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763] [ENSMUST00000133317] [ENSMUST00000208369]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057892
AA Change: V2799E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: V2799E

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
coiled coil region	864	894	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1062	1072	N/A	INTRINSIC
low complexity region	1086	1098	N/A	INTRINSIC
low complexity region	1225	1238	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1491	1503	N/A	INTRINSIC
low complexity region	1594	1613	N/A	INTRINSIC
low complexity region	1636	1645	N/A	INTRINSIC
low complexity region	1665	1683	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
coiled coil region	1908	1936	N/A	INTRINSIC
low complexity region	1941	1957	N/A	INTRINSIC
low complexity region	2051	2061	N/A	INTRINSIC
low complexity region	2092	2107	N/A	INTRINSIC
low complexity region	2115	2128	N/A	INTRINSIC
low complexity region	2175	2197	N/A	INTRINSIC
low complexity region	2227	2252	N/A	INTRINSIC
low complexity region	2275	2312	N/A	INTRINSIC
low complexity region	2336	2355	N/A	INTRINSIC
low complexity region	2361	2378	N/A	INTRINSIC
low complexity region	2390	2420	N/A	INTRINSIC
low complexity region	2430	2463	N/A	INTRINSIC
coiled coil region	2489	2527	N/A	INTRINSIC
coiled coil region	2576	2604	N/A	INTRINSIC
low complexity region	2663	2700	N/A	INTRINSIC
low complexity region	2713	2736	N/A	INTRINSIC
PHD	2744	2791	5.32e-9	SMART
BROMO	2800	2908	5.5e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106762
AA Change: V2851E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: V2851E

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
internal_repeat_1	589	642	6.48e-5	PROSPERO
low complexity region	644	654	N/A	INTRINSIC
low complexity region	662	679	N/A	INTRINSIC
coiled coil region	926	956	N/A	INTRINSIC
low complexity region	1013	1025	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1114	1124	N/A	INTRINSIC
low complexity region	1138	1150	N/A	INTRINSIC
low complexity region	1277	1290	N/A	INTRINSIC
low complexity region	1303	1317	N/A	INTRINSIC
internal_repeat_1	1387	1440	6.48e-5	PROSPERO
low complexity region	1543	1555	N/A	INTRINSIC
low complexity region	1646	1665	N/A	INTRINSIC
low complexity region	1688	1697	N/A	INTRINSIC
low complexity region	1717	1735	N/A	INTRINSIC
low complexity region	1870	1886	N/A	INTRINSIC
coiled coil region	1960	1988	N/A	INTRINSIC
low complexity region	1993	2009	N/A	INTRINSIC
low complexity region	2103	2113	N/A	INTRINSIC
low complexity region	2144	2159	N/A	INTRINSIC
low complexity region	2167	2180	N/A	INTRINSIC
low complexity region	2227	2249	N/A	INTRINSIC
low complexity region	2279	2304	N/A	INTRINSIC
low complexity region	2327	2364	N/A	INTRINSIC
low complexity region	2388	2407	N/A	INTRINSIC
low complexity region	2413	2430	N/A	INTRINSIC
low complexity region	2442	2472	N/A	INTRINSIC
low complexity region	2482	2515	N/A	INTRINSIC
coiled coil region	2541	2579	N/A	INTRINSIC
coiled coil region	2628	2656	N/A	INTRINSIC
low complexity region	2715	2752	N/A	INTRINSIC
low complexity region	2765	2788	N/A	INTRINSIC
PHD	2796	2843	5.32e-9	SMART
BROMO	2852	2960	5.5e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106763
AA Change: V2914E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: V2914E

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.9e-8	PFAM
PHD	404	447	2.23e-11	SMART
low complexity region	624	639	N/A	INTRINSIC
low complexity region	707	717	N/A	INTRINSIC
low complexity region	725	742	N/A	INTRINSIC
coiled coil region	989	1019	N/A	INTRINSIC
low complexity region	1076	1088	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
low complexity region	1201	1213	N/A	INTRINSIC
low complexity region	1340	1353	N/A	INTRINSIC
low complexity region	1366	1380	N/A	INTRINSIC
low complexity region	1606	1618	N/A	INTRINSIC
low complexity region	1709	1728	N/A	INTRINSIC
low complexity region	1751	1760	N/A	INTRINSIC
low complexity region	1780	1798	N/A	INTRINSIC
low complexity region	1933	1949	N/A	INTRINSIC
coiled coil region	2023	2051	N/A	INTRINSIC
low complexity region	2056	2072	N/A	INTRINSIC
low complexity region	2166	2176	N/A	INTRINSIC
low complexity region	2207	2222	N/A	INTRINSIC
low complexity region	2230	2243	N/A	INTRINSIC
low complexity region	2290	2312	N/A	INTRINSIC
low complexity region	2342	2367	N/A	INTRINSIC
low complexity region	2390	2427	N/A	INTRINSIC
low complexity region	2451	2470	N/A	INTRINSIC
low complexity region	2476	2493	N/A	INTRINSIC
low complexity region	2505	2535	N/A	INTRINSIC
low complexity region	2545	2578	N/A	INTRINSIC
coiled coil region	2604	2642	N/A	INTRINSIC
coiled coil region	2691	2719	N/A	INTRINSIC
low complexity region	2778	2815	N/A	INTRINSIC
low complexity region	2828	2851	N/A	INTRINSIC
PHD	2859	2906	5.32e-9	SMART
BROMO	2915	3023	5.5e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133317

SMART Domains

Protein: ENSMUSP00000118875
Gene: ENSMUSG00000040481

Domain	Start	End	E-Value	Type
low complexity region	57	94	N/A	INTRINSIC
low complexity region	107	130	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147816

Predicted Effect

probably benign
Transcript: ENSMUST00000208369
AA Change: V217E

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

Meta Mutation Damage Score

0.1805

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]

Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	T	G	5: 146,185,219	S18R	probably benign	Het
2010315B03Rik	A	C	9: 124,293,766	V176G	probably benign	Het
Abcb1a	T	A	5: 8,715,732		probably null	Het
Acad11	C	A	9: 104,075,877	P102T	probably damaging	Het
Aggf1	T	A	13: 95,364,713	D387V	probably damaging	Het
Akr1c13	G	A	13: 4,198,497	V234I	probably benign	Het
Alg5	A	G	3: 54,746,473	Y210C	possibly damaging	Het
Arl8a	C	A	1: 135,147,099	A41E	probably benign	Het
Axin1	C	A	17: 26,173,756	T337K	possibly damaging	Het
Bdp1	A	G	13: 100,056,267	L1353P	probably damaging	Het
C9	A	T	15: 6,459,643	E160D	probably damaging	Het
Cbx6	T	C	15: 79,828,680	D182G	probably damaging	Het
Ccdc144b	T	G	3: 36,010,660	*521C	probably null	Het
Cep57l1	T	C	10: 41,721,682	R242G	possibly damaging	Het
Chst8	T	C	7: 34,675,724	D230G	probably damaging	Het
Col3a1	A	C	1: 45,346,110	D129A	probably damaging	Het
Cst12	A	G	2: 148,789,473	E38G	possibly damaging	Het
Disp1	G	T	1: 183,088,096	A920E	probably damaging	Het
Dtna	T	G	18: 23,535,149		probably null	Het
Elp3	T	A	14: 65,582,929	H97L	probably damaging	Het
Exoc8	A	G	8: 124,897,575	F18L	possibly damaging	Het
Extl3	T	C	14: 65,077,320	T138A	probably benign	Het
Foxi2	G	T	7: 135,410,667	G95C	probably damaging	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Frem1	A	T	4: 82,989,189	D811E	probably damaging	Het
Frmd4a	A	T	2: 4,603,448	E709V	probably damaging	Het
Fscn3	T	A	6: 28,436,201	*499K	probably null	Het
Galc	C	T	12: 98,242,744	G217D	possibly damaging	Het
Gm5592	G	T	7: 41,216,118		probably benign	Het
Hnrnpul1	A	G	7: 25,743,011	S269P	probably benign	Het
Hrh1	T	C	6: 114,480,535	V259A	probably benign	Het
Lef1	T	C	3: 131,184,733	S167P	probably benign	Het
Mtf2	T	C	5: 108,093,352	I248T	probably benign	Het
Muc2	C	T	7: 141,745,608	T130M	possibly damaging	Het
Myo16	T	C	8: 10,435,880	F653S	probably damaging	Het
Myo1e	T	C	9: 70,343,135		probably null	Het
Myo5a	G	T	9: 75,116,336		probably benign	Het
Nlrp1b	T	A	11: 71,182,663	D118V	probably damaging	Het
Npat	T	C	9: 53,572,620	F1412S	probably damaging	Het
Olfr1377	G	A	11: 50,984,775	E25K	probably benign	Het
Olfr884	T	G	9: 38,048,140	L306R	probably benign	Het
Onecut3	G	T	10: 80,495,707	A234S	unknown	Het
Osbpl6	T	A	2: 76,546,000	I73K	probably damaging	Het
Otog	C	T	7: 46,288,519	T1884I	probably benign	Het
Pax6	C	A	2: 105,696,502	P251Q	probably benign	Het
Pias4	A	G	10: 81,164,034	Y62H	possibly damaging	Het
Pknox1	T	A	17: 31,590,713	V97D	possibly damaging	Het
Plekhf1	A	G	7: 38,221,598	V182A	probably damaging	Het
Plscr4	T	C	9: 92,484,780	V149A	probably damaging	Het
Polr2l	A	T	7: 141,473,396	L35Q	probably damaging	Het
Ppp3ca	T	C	3: 136,890,489	I305T	probably damaging	Het
Ptprg	G	A	14: 12,122,068	A311T	probably benign	Het
Raet1e	T	G	10: 22,181,332	I185R	probably damaging	Het
Rims1	A	C	1: 22,479,462	V520G	probably damaging	Het
Rp1	A	T	1: 4,345,878	D1670E	probably damaging	Het
Rps6ka1	A	T	4: 133,860,557	I352N	probably damaging	Het
Rtp3	T	C	9: 110,987,350		probably benign	Het
Ryr3	T	A	2: 112,733,031		probably null	Het
Sall3	A	G	18: 80,974,476	V79A	probably damaging	Het
Sdsl	C	T	5: 120,462,054	V93M	probably damaging	Het
Slc7a13	A	G	4: 19,819,390	N197D	probably benign	Het
Slit1	T	A	19: 41,721,044	R137*	probably null	Het
Stxbp5	C	A	10: 9,770,623	R115L	probably damaging	Het
Tcea1	G	A	1: 4,894,944	R290H	probably damaging	Het
Tmem132e	A	T	11: 82,434,512	T113S	probably damaging	Het
Tpp1	A	T	7: 105,749,251	I286N	probably damaging	Het
Trio	G	A	15: 27,732,538	R3086*	probably null	Het
Usp22	T	A	11: 61,160,636	N294Y	probably damaging	Het
Usp44	T	A	10: 93,846,071	S128T	probably benign	Het
Zc3h7b	T	C	15: 81,769,183		probably null	Het
Zfhx2	T	C	14: 55,066,915	Y1204C	possibly damaging	Het

Other mutations in Bptf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Bptf	APN	11	107055279	missense	possibly damaging	0.88
IGL00664:Bptf	APN	11	107077665	missense	possibly damaging	0.78
IGL00705:Bptf	APN	11	107095708	splice site	probably benign
IGL00796:Bptf	APN	11	107054550	missense	probably damaging	1.00
IGL00834:Bptf	APN	11	107073928	missense	possibly damaging	0.59
IGL01155:Bptf	APN	11	107080727	missense	probably damaging	1.00
IGL01314:Bptf	APN	11	107054853	missense	probably damaging	1.00
IGL01371:Bptf	APN	11	107055907	missense	probably benign	0.00
IGL01567:Bptf	APN	11	107058774	missense	probably damaging	1.00
IGL01794:Bptf	APN	11	107053221	critical splice donor site	probably null
IGL02108:Bptf	APN	11	107074988	missense	probably benign	0.45
IGL02367:Bptf	APN	11	107073352	missense	probably benign
IGL02437:Bptf	APN	11	107074695	missense	probably benign	0.00
IGL02589:Bptf	APN	11	107111531	missense	possibly damaging	0.92
IGL02897:Bptf	APN	11	107047121	missense	probably damaging	1.00
IGL02935:Bptf	APN	11	107080799	missense	probably damaging	1.00
IGL02954:Bptf	APN	11	107054749	missense	possibly damaging	0.89
IGL02982:Bptf	APN	11	107076674	missense	probably damaging	1.00
IGL03109:Bptf	APN	11	107061701	missense	possibly damaging	0.53
IGL03265:Bptf	APN	11	107054628	missense	probably benign	0.00
IGL03403:Bptf	APN	11	107099733	missense	possibly damaging	0.51
Anodyne	UTSW	11	107043631	critical splice donor site	probably null
Arroyo	UTSW	11	107042690	missense	probably benign	0.32
mojado	UTSW	11	107044640	missense	probably benign	0.03
IGL03097:Bptf	UTSW	11	107077680	missense	probably damaging	1.00
PIT4486001:Bptf	UTSW	11	107054788	missense	probably damaging	0.98
R0066:Bptf	UTSW	11	107062136	missense	possibly damaging	0.90
R0157:Bptf	UTSW	11	107074658	missense	possibly damaging	0.89
R0320:Bptf	UTSW	11	107072819	missense	probably damaging	1.00
R0328:Bptf	UTSW	11	107047127	missense	probably damaging	1.00
R0402:Bptf	UTSW	11	107074114	missense	probably damaging	1.00
R0482:Bptf	UTSW	11	107081262	missense	probably benign	0.13
R0574:Bptf	UTSW	11	107076527	missense	probably damaging	1.00
R0598:Bptf	UTSW	11	107072965	missense	probably damaging	0.99
R0599:Bptf	UTSW	11	107068382	missense	probably damaging	1.00
R0601:Bptf	UTSW	11	107061692	missense	probably benign	0.04
R0744:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0836:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0885:Bptf	UTSW	11	107043791	missense	probably damaging	1.00
R1070:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1252:Bptf	UTSW	11	107073251	missense	probably benign	0.00
R1370:Bptf	UTSW	11	107047094	missense	probably damaging	0.99
R1428:Bptf	UTSW	11	107073047	missense	probably damaging	0.99
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1742:Bptf	UTSW	11	107110951	missense	probably damaging	1.00
R1816:Bptf	UTSW	11	107060579	missense	probably damaging	1.00
R1858:Bptf	UTSW	11	107073301	missense	probably benign	0.00
R1989:Bptf	UTSW	11	107074826	missense	probably damaging	1.00
R2253:Bptf	UTSW	11	107111322	missense	probably damaging	1.00
R2392:Bptf	UTSW	11	107072747	missense	probably damaging	1.00
R2431:Bptf	UTSW	11	107047240	missense	possibly damaging	0.48
R3022:Bptf	UTSW	11	107111637	critical splice acceptor site	probably null
R3161:Bptf	UTSW	11	107074476	missense	probably damaging	1.00
R3686:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3687:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3688:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3787:Bptf	UTSW	11	107073827	missense	probably damaging	1.00
R3834:Bptf	UTSW	11	107073857	missense	probably benign	0.05
R3885:Bptf	UTSW	11	107074513	missense	probably damaging	0.97
R4090:Bptf	UTSW	11	107081523	missense	probably damaging	0.99
R4398:Bptf	UTSW	11	107110844	missense	probably damaging	1.00
R4437:Bptf	UTSW	11	107074474	missense	possibly damaging	0.59
R4514:Bptf	UTSW	11	107077692	missense	probably damaging	1.00
R4565:Bptf	UTSW	11	107073010	missense	probably damaging	1.00
R4715:Bptf	UTSW	11	107047181	missense	probably damaging	1.00
R4748:Bptf	UTSW	11	107095880	missense	probably damaging	0.96
R4885:Bptf	UTSW	11	107074648	missense	probably benign	0.39
R4901:Bptf	UTSW	11	107110860	nonsense	probably null
R4995:Bptf	UTSW	11	107054565	missense	probably damaging	0.98
R5057:Bptf	UTSW	11	107082528	missense	probably damaging	0.98
R5120:Bptf	UTSW	11	107073385	missense	probably damaging	0.99
R5320:Bptf	UTSW	11	107081367	nonsense	probably null
R5329:Bptf	UTSW	11	107073295	missense	probably benign	0.06
R5418:Bptf	UTSW	11	107111294	missense	probably damaging	1.00
R5461:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R5664:Bptf	UTSW	11	107073699	missense	probably benign	0.01
R5718:Bptf	UTSW	11	107111434	missense	probably damaging	1.00
R5774:Bptf	UTSW	11	107111137	missense	probably damaging	1.00
R5851:Bptf	UTSW	11	107110862	missense	probably damaging	1.00
R5930:Bptf	UTSW	11	107073196	missense	probably damaging	1.00
R5949:Bptf	UTSW	11	107111089	missense	probably damaging	0.99
R5975:Bptf	UTSW	11	107035864	utr 3 prime	probably benign
R6027:Bptf	UTSW	11	107074945	missense	probably damaging	1.00
R6128:Bptf	UTSW	11	107074690	missense	possibly damaging	0.87
R6337:Bptf	UTSW	11	107058779	missense	possibly damaging	0.89
R6407:Bptf	UTSW	11	107111126	missense	probably damaging	1.00
R6470:Bptf	UTSW	11	107072767	missense	probably damaging	1.00
R6487:Bptf	UTSW	11	107077726	missense	probably damaging	0.99
R6501:Bptf	UTSW	11	107077683	missense	probably null	1.00
R6755:Bptf	UTSW	11	107047256	missense	probably benign	0.27
R6861:Bptf	UTSW	11	107062565	missense	probably damaging	1.00
R6866:Bptf	UTSW	11	107073580	missense	probably damaging	1.00
R6879:Bptf	UTSW	11	107042690	missense	probably benign	0.32
R6927:Bptf	UTSW	11	107054595	missense	probably damaging	1.00
R6944:Bptf	UTSW	11	107080823	missense	probably damaging	1.00
R7082:Bptf	UTSW	11	107086747	missense	probably benign	0.00
R7136:Bptf	UTSW	11	107099715	missense	probably damaging	1.00
R7162:Bptf	UTSW	11	107043631	critical splice donor site	probably null
R7171:Bptf	UTSW	11	107131407	missense	unknown
R7193:Bptf	UTSW	11	107054809	nonsense	probably null
R7210:Bptf	UTSW	11	107054464	nonsense	probably null
R7221:Bptf	UTSW	11	107054832	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107073109	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107110914	nonsense	probably null
R7422:Bptf	UTSW	11	107060558	missense	probably damaging	1.00
R7454:Bptf	UTSW	11	107044640	missense	probably benign	0.03
R7657:Bptf	UTSW	11	107074729	missense	probably damaging	1.00
R7718:Bptf	UTSW	11	107081456	missense	possibly damaging	0.65
R7827:Bptf	UTSW	11	107047187	missense	probably benign	0.01
R7844:Bptf	UTSW	11	107074061	missense	probably damaging	0.97
R7992:Bptf	UTSW	11	107110883	missense	probably benign	0.00
R8001:Bptf	UTSW	11	107047340	nonsense	probably null
R8037:Bptf	UTSW	11	107055950	missense	probably damaging	1.00
R8122:Bptf	UTSW	11	107036591	critical splice acceptor site	probably null
R8235:Bptf	UTSW	11	107076632	missense	probably benign	0.04
R8308:Bptf	UTSW	11	107052989	missense	probably damaging	0.99
R8409:Bptf	UTSW	11	107062669	missense	probably damaging	1.00
R8464:Bptf	UTSW	11	107131342	missense	probably benign	0.01
R8477:Bptf	UTSW	11	107052853	missense	probably damaging	0.98
R8482:Bptf	UTSW	11	107043698	missense	probably benign	0.19
R8515:Bptf	UTSW	11	107055238	missense	possibly damaging	0.85
R8519:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R8708:Bptf	UTSW	11	107073313	missense	probably damaging	0.99
R8708:Bptf	UTSW	11	107073314	missense	probably damaging	1.00
R8722:Bptf	UTSW	11	107131469	missense	unknown
R8732:Bptf	UTSW	11	107040380	missense	probably damaging	1.00
R8783:Bptf	UTSW	11	107131531	missense	unknown
R8828:Bptf	UTSW	11	107055010	missense	probably damaging	0.98
R9004:Bptf	UTSW	11	107054887	missense	probably damaging	1.00
R9010:Bptf	UTSW	11	107073750	missense	probably damaging	1.00
R9035:Bptf	UTSW	11	107073016	missense	probably damaging	1.00
R9083:Bptf	UTSW	11	107068350	missense	probably damaging	1.00
R9211:Bptf	UTSW	11	107055298	missense	probably damaging	1.00
R9345:Bptf	UTSW	11	107080762	missense	possibly damaging	0.77
R9393:Bptf	UTSW	11	107074308	missense	probably benign	0.00
R9451:Bptf	UTSW	11	107044585	missense	probably damaging	1.00
R9561:Bptf	UTSW	11	107074128	nonsense	probably null
R9632:Bptf	UTSW	11	107061719	missense	probably damaging	1.00
R9648:Bptf	UTSW	11	107052894	missense	probably damaging	0.99
R9650:Bptf	UTSW	11	107044586	missense	probably benign	0.15
R9658:Bptf	UTSW	11	107111344	missense	probably damaging	1.00
R9775:Bptf	UTSW	11	107043676	missense	probably benign	0.04
R9776:Bptf	UTSW	11	107078570	missense	probably damaging	1.00
Z1088:Bptf	UTSW	11	107074582	missense	probably benign	0.00
Z1176:Bptf	UTSW	11	107058684	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTAAACTTCATGTCACCGGC -3'
(R):5'- AGAAGCAGCCAGTCCTTTG -3'

Sequencing Primer
(F):5'- AGAGGTGCCCTTTGTCCAG -3'
(R):5'- GGCCTCACATTTCCATTTTGG -3'

Posted On

2015-11-11