Incidental Mutation 'R4764:Galc'
ID357125
Institutional Source Beutler Lab
Gene Symbol Galc
Ensembl Gene ENSMUSG00000021003
Gene Namegalactosylceramidase
SynonymsGacy, A930008M05Rik, 2310068B06Rik, galactocerebrosidase
MMRRC Submission 042405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4764 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98202294-98259459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98242744 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 217 (G217D)
Ref Sequence ENSEMBL: ENSMUSP00000021390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021390]
PDB Structure
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE [X-RAY DIFFRACTION]
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE IN COMPLEX WITH GALACTOSE [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH 4NBDG: ENZYME-SUBSTRATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH D-GALACTAL: ENZYME- INTERMEDIATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH GALACTOSE: ENZYME- PRODUCT COMPLEX [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021390
AA Change: G217D

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021390
Gene: ENSMUSG00000021003
AA Change: G217D

DomainStartEndE-ValueType
Pfam:Glyco_hydro_59 17 684 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220501
Predicted Effect unknown
Transcript: ENSMUST00000221063
AA Change: G23D
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222042
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes galactosylceramidase, the lysosomal hydryolase involved in the catabolism of galactosylceramide. Mutations in this gene result in slow growth, tremors and hind leg weakness, collectively termed as the 'twitcher' phenotype. In humans, deficiency of this gene product causes a lysosomal storage disorder known as Krabbe disease. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for spontaneous and targeted mutations exhibit tremors, progressive weakness, wasting, both central and peripheral demyelination, massive accumulation of galactosylceramide, abnormal macrophages, and death by 4 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T G 5: 146,185,219 S18R probably benign Het
2010315B03Rik A C 9: 124,293,766 V176G probably benign Het
Abcb1a T A 5: 8,715,732 probably null Het
Acad11 C A 9: 104,075,877 P102T probably damaging Het
Aggf1 T A 13: 95,364,713 D387V probably damaging Het
Akr1c13 G A 13: 4,198,497 V234I probably benign Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Arl8a C A 1: 135,147,099 A41E probably benign Het
Axin1 C A 17: 26,173,756 T337K possibly damaging Het
Bdp1 A G 13: 100,056,267 L1353P probably damaging Het
Bptf A T 11: 107,043,694 V2851E probably damaging Het
C9 A T 15: 6,459,643 E160D probably damaging Het
Cbx6 T C 15: 79,828,680 D182G probably damaging Het
Ccdc144b T G 3: 36,010,660 *521C probably null Het
Cep57l1 T C 10: 41,721,682 R242G possibly damaging Het
Chst8 T C 7: 34,675,724 D230G probably damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Cst12 A G 2: 148,789,473 E38G possibly damaging Het
Disp1 G T 1: 183,088,096 A920E probably damaging Het
Dtna T G 18: 23,535,149 probably null Het
Elp3 T A 14: 65,582,929 H97L probably damaging Het
Exoc8 A G 8: 124,897,575 F18L possibly damaging Het
Extl3 T C 14: 65,077,320 T138A probably benign Het
Foxi2 G T 7: 135,410,667 G95C probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Frem1 A T 4: 82,989,189 D811E probably damaging Het
Frmd4a A T 2: 4,603,448 E709V probably damaging Het
Fscn3 T A 6: 28,436,201 *499K probably null Het
Gm5592 G T 7: 41,216,118 probably benign Het
Hnrnpul1 A G 7: 25,743,011 S269P probably benign Het
Hrh1 T C 6: 114,480,535 V259A probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Mtf2 T C 5: 108,093,352 I248T probably benign Het
Muc2 C T 7: 141,745,608 T130M possibly damaging Het
Myo16 T C 8: 10,435,880 F653S probably damaging Het
Myo1e T C 9: 70,343,135 probably null Het
Myo5a G T 9: 75,116,336 probably benign Het
Nlrp1b T A 11: 71,182,663 D118V probably damaging Het
Npat T C 9: 53,572,620 F1412S probably damaging Het
Olfr1377 G A 11: 50,984,775 E25K probably benign Het
Olfr884 T G 9: 38,048,140 L306R probably benign Het
Onecut3 G T 10: 80,495,707 A234S unknown Het
Osbpl6 T A 2: 76,546,000 I73K probably damaging Het
Otog C T 7: 46,288,519 T1884I probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pias4 A G 10: 81,164,034 Y62H possibly damaging Het
Pknox1 T A 17: 31,590,713 V97D possibly damaging Het
Plekhf1 A G 7: 38,221,598 V182A probably damaging Het
Plscr4 T C 9: 92,484,780 V149A probably damaging Het
Polr2l A T 7: 141,473,396 L35Q probably damaging Het
Ppp3ca T C 3: 136,890,489 I305T probably damaging Het
Ptprg G A 14: 12,122,068 A311T probably benign Het
Raet1e T G 10: 22,181,332 I185R probably damaging Het
Rims1 A C 1: 22,479,462 V520G probably damaging Het
Rp1 A T 1: 4,345,878 D1670E probably damaging Het
Rps6ka1 A T 4: 133,860,557 I352N probably damaging Het
Rtp3 T C 9: 110,987,350 probably benign Het
Ryr3 T A 2: 112,733,031 probably null Het
Sall3 A G 18: 80,974,476 V79A probably damaging Het
Sdsl C T 5: 120,462,054 V93M probably damaging Het
Slc7a13 A G 4: 19,819,390 N197D probably benign Het
Slit1 T A 19: 41,721,044 R137* probably null Het
Stxbp5 C A 10: 9,770,623 R115L probably damaging Het
Tcea1 G A 1: 4,894,944 R290H probably damaging Het
Tmem132e A T 11: 82,434,512 T113S probably damaging Het
Tpp1 A T 7: 105,749,251 I286N probably damaging Het
Trio G A 15: 27,732,538 R3086* probably null Het
Usp22 T A 11: 61,160,636 N294Y probably damaging Het
Usp44 T A 10: 93,846,071 S128T probably benign Het
Zc3h7b T C 15: 81,769,183 probably null Het
Zfhx2 T C 14: 55,066,915 Y1204C possibly damaging Het
Other mutations in Galc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Galc APN 12 98231422 missense probably benign
IGL01287:Galc APN 12 98246244 unclassified probably benign
IGL01618:Galc APN 12 98252081 missense possibly damaging 0.92
IGL02125:Galc APN 12 98231509 missense probably damaging 1.00
IGL02274:Galc APN 12 98254214 nonsense probably null
IGL02392:Galc APN 12 98207413 missense probably damaging 0.99
IGL02478:Galc APN 12 98213132 missense possibly damaging 0.96
IGL02544:Galc APN 12 98231442 missense probably benign 0.27
IGL03268:Galc APN 12 98222593 splice site probably benign
IGL03327:Galc APN 12 98207476 splice site probably benign
Crabby2 UTSW 12 98234266 missense probably damaging 1.00
Krabbe UTSW 12 98222647 missense probably damaging 1.00
lobster UTSW 12 98246255 missense probably null 0.84
quake UTSW 12 98242714 missense probably damaging 1.00
teeter UTSW 12 98259162 missense probably damaging 1.00
R0218:Galc UTSW 12 98222647 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0467:Galc UTSW 12 98242645 missense probably damaging 1.00
R1619:Galc UTSW 12 98234304 missense probably benign 0.00
R1763:Galc UTSW 12 98234266 missense probably damaging 1.00
R1832:Galc UTSW 12 98234240 critical splice donor site probably null
R1844:Galc UTSW 12 98246297 unclassified probably null
R1996:Galc UTSW 12 98252026 missense probably damaging 1.00
R2010:Galc UTSW 12 98254230 missense possibly damaging 0.51
R2097:Galc UTSW 12 98252032 missense probably benign
R2496:Galc UTSW 12 98227281 missense probably damaging 1.00
R2881:Galc UTSW 12 98213096 missense probably benign
R3009:Galc UTSW 12 98203969 missense probably damaging 1.00
R4571:Galc UTSW 12 98222617 missense probably benign 0.00
R4851:Galc UTSW 12 98227274 missense probably benign 0.00
R4854:Galc UTSW 12 98256877 missense probably damaging 1.00
R4900:Galc UTSW 12 98231472 missense probably damaging 1.00
R4983:Galc UTSW 12 98242768 nonsense probably null
R5220:Galc UTSW 12 98231413 splice site probably null
R5273:Galc UTSW 12 98252071 missense probably damaging 1.00
R5495:Galc UTSW 12 98231414 critical splice donor site probably null
R5689:Galc UTSW 12 98212986 missense possibly damaging 0.94
R5819:Galc UTSW 12 98216261 missense probably benign 0.06
R6191:Galc UTSW 12 98252034 missense probably damaging 1.00
R6196:Galc UTSW 12 98259162 missense probably damaging 1.00
R6305:Galc UTSW 12 98259290 missense possibly damaging 0.57
R6335:Galc UTSW 12 98242714 missense probably damaging 1.00
R7255:Galc UTSW 12 98246255 missense probably null 0.84
R7496:Galc UTSW 12 98259238 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGAGTAAATACTGCCATAGGAG -3'
(R):5'- ATTATGCCGGACACCCAGTC -3'

Sequencing Primer
(F):5'- TACTGCCATAGGAGTGTAATCCAG -3'
(R):5'- AGTCCTCTGAGAAGCAGTGC -3'
Posted On2015-11-11