Incidental Mutation 'R0403:Ros1'
ID 35713
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene Name Ros1 proto-oncogene
Synonyms Ros-1, c-ros
MMRRC Submission 038608-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R0403 (G1)
Quality Score 172
Status Validated
Chromosome 10
Chromosomal Location 51921817-52071340 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 52019534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
AlphaFold Q78DX7
Predicted Effect probably benign
Transcript: ENSMUST00000020045
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000135235
Gene: ENSMUSG00000019893

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 100 178 1.05e-4 SMART
FN3 196 273 7.45e-10 SMART
Blast:LY 360 400 1e-20 BLAST
Blast:LY 449 486 4e-15 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218452
Predicted Effect probably benign
Transcript: ENSMUST00000219173
Predicted Effect probably benign
Transcript: ENSMUST00000219692
Coding Region Coverage
  • 1x: 98.0%
  • 3x: 96.8%
  • 10x: 93.2%
  • 20x: 83.7%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,864,706 (GRCm39) probably null Het
Adgrg3 C T 8: 95,763,550 (GRCm39) L284F probably benign Het
Alkbh8 T A 9: 3,385,469 (GRCm39) V587E probably damaging Het
Ap4b1 T A 3: 103,728,712 (GRCm39) M590K probably benign Het
Ap4b1 T A 3: 103,726,155 (GRCm39) C244S probably damaging Het
Arhgap15 C T 2: 43,953,778 (GRCm39) T168I probably damaging Het
Atp8b1 A G 18: 64,673,381 (GRCm39) V997A probably damaging Het
Atrn G A 2: 130,748,779 (GRCm39) C100Y probably damaging Het
Baiap2l2 C A 15: 79,155,416 (GRCm39) A151S probably benign Het
Baz2b A T 2: 59,799,721 (GRCm39) D199E possibly damaging Het
Bmal2 T A 6: 146,724,153 (GRCm39) H348Q probably damaging Het
Cblb A G 16: 51,972,989 (GRCm39) D440G probably benign Het
Cdon T C 9: 35,384,796 (GRCm39) V694A probably benign Het
Cep250 A T 2: 155,834,269 (GRCm39) R2065W probably damaging Het
Ces2b G T 8: 105,560,577 (GRCm39) A131S probably damaging Het
Chrna9 A T 5: 66,125,235 (GRCm39) T59S possibly damaging Het
Cog3 T A 14: 75,979,767 (GRCm39) probably benign Het
Cpa1 G A 6: 30,641,856 (GRCm39) V227I probably benign Het
Cyp3a25 A T 5: 145,935,323 (GRCm39) C98S probably damaging Het
D8Ertd738e C T 8: 84,976,230 (GRCm39) probably null Het
Ddx60 A G 8: 62,447,575 (GRCm39) probably benign Het
Dhx16 T C 17: 36,193,942 (GRCm39) probably null Het
Dnah9 T A 11: 65,975,615 (GRCm39) Q1478L possibly damaging Het
Dock10 T C 1: 80,501,787 (GRCm39) Y1434C possibly damaging Het
Enpp3 T A 10: 24,680,334 (GRCm39) D325V probably damaging Het
Entpd6 C A 2: 150,602,090 (GRCm39) T194K possibly damaging Het
Fat2 A T 11: 55,161,175 (GRCm39) V3185E probably benign Het
Flrt1 A G 19: 7,073,284 (GRCm39) L421P probably benign Het
Fmn2 A T 1: 174,521,844 (GRCm39) Q1292L probably damaging Het
Fndc1 T C 17: 7,972,555 (GRCm39) D1459G probably damaging Het
Fndc1 T C 17: 7,994,420 (GRCm39) probably null Het
Fzr1 A G 10: 81,205,202 (GRCm39) S265P possibly damaging Het
Gpr142 G A 11: 114,696,855 (GRCm39) V134M probably damaging Het
Grid2ip G T 5: 143,343,375 (GRCm39) V24L possibly damaging Het
Herc2 G A 7: 55,809,165 (GRCm39) R2555H probably damaging Het
Hpdl A T 4: 116,677,676 (GRCm39) Y262N possibly damaging Het
Htr3a A G 9: 48,819,959 (GRCm39) V57A probably damaging Het
Igfbp7 T C 5: 77,503,438 (GRCm39) I186V probably benign Het
Itga2b C T 11: 102,358,152 (GRCm39) probably null Het
Itgae A C 11: 73,014,009 (GRCm39) D736A possibly damaging Het
Itpkc T A 7: 26,907,770 (GRCm39) M645L probably benign Het
Jchain T C 5: 88,669,237 (GRCm39) R139G probably benign Het
Kif13a A G 13: 46,944,877 (GRCm39) V908A probably damaging Het
Kif1b T A 4: 149,266,424 (GRCm39) K389* probably null Het
Klhl12 T C 1: 134,413,594 (GRCm39) Y360H possibly damaging Het
Knop1 G A 7: 118,452,276 (GRCm39) R148W probably damaging Het
Lpar1 T A 4: 58,487,191 (GRCm39) N27Y probably damaging Het
Lpar2 T A 8: 70,276,802 (GRCm39) V197D probably damaging Het
Lrrc74a A G 12: 86,787,753 (GRCm39) N128S probably damaging Het
Lum G T 10: 97,407,905 (GRCm39) V337F probably benign Het
Mag T C 7: 30,606,405 (GRCm39) D344G probably damaging Het
Maip1 G A 1: 57,446,355 (GRCm39) A142T probably benign Het
Mlh3 A G 12: 85,315,742 (GRCm39) V148A possibly damaging Het
Nav3 A G 10: 109,602,964 (GRCm39) V1195A probably damaging Het
Ncor2 A G 5: 125,110,401 (GRCm39) S868P possibly damaging Het
Nek1 A G 8: 61,559,889 (GRCm39) E907G probably damaging Het
Nfam1 G A 15: 82,900,580 (GRCm39) T134I probably benign Het
Nr0b2 T C 4: 133,281,070 (GRCm39) V112A probably damaging Het
Nrp1 A G 8: 129,184,450 (GRCm39) N365S probably damaging Het
Nrsn2 T C 2: 152,211,710 (GRCm39) Y107C probably damaging Het
Ntng1 G A 3: 109,841,927 (GRCm39) A282V probably damaging Het
Nxf1 T C 19: 8,742,392 (GRCm39) I337T probably damaging Het
Obscn C T 11: 58,967,366 (GRCm39) G479D probably damaging Het
Oprd1 T A 4: 131,841,079 (GRCm39) D293V probably benign Het
Or13a17 T C 7: 140,271,222 (GRCm39) S135P possibly damaging Het
P3h2 T G 16: 25,788,700 (GRCm39) N586H possibly damaging Het
Pcid2 T C 8: 13,135,367 (GRCm39) Y214C probably damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Pkd1l3 G A 8: 110,350,295 (GRCm39) S380N probably benign Het
Ppic C A 18: 53,544,143 (GRCm39) G81W probably damaging Het
Ppp2r1a C A 17: 21,177,303 (GRCm39) P246T probably damaging Het
Ppp4r4 T G 12: 103,550,361 (GRCm39) S46A probably benign Het
Pramel31 A G 4: 144,089,216 (GRCm39) N178S probably benign Het
Prkce A G 17: 86,476,081 (GRCm39) T21A probably damaging Het
Prkg2 T C 5: 99,142,504 (GRCm39) E210G possibly damaging Het
Prss35 A G 9: 86,638,090 (GRCm39) M287V probably damaging Het
Psd G A 19: 46,309,411 (GRCm39) probably benign Het
Ptch2 A T 4: 116,968,036 (GRCm39) K843* probably null Het
Rab44 C A 17: 29,364,235 (GRCm39) T603K probably damaging Het
Rasal3 T A 17: 32,611,764 (GRCm39) probably null Het
Rbbp6 A G 7: 122,591,519 (GRCm39) T526A probably damaging Het
Sec24b T A 3: 129,783,325 (GRCm39) L1104F possibly damaging Het
Sec24b A G 3: 129,793,183 (GRCm39) S685P probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Setmar A T 6: 108,052,923 (GRCm39) H139L probably benign Het
Slc28a2b T C 2: 122,352,335 (GRCm39) L364S probably damaging Het
Slc4a7 T C 14: 14,766,808 (GRCm38) V710A probably benign Het
Smarcc1 T A 9: 110,066,876 (GRCm39) probably null Het
Smchd1 G A 17: 71,701,897 (GRCm39) L1032F probably damaging Het
Speg T C 1: 75,407,428 (GRCm39) probably benign Het
Tasor2 A T 13: 3,632,052 (GRCm39) Y816* probably null Het
Tcea1 C G 1: 4,959,726 (GRCm39) R134G probably benign Het
Tchhl1 C T 3: 93,378,336 (GRCm39) Q347* probably null Het
Tecrl A T 5: 83,502,605 (GRCm39) probably benign Het
Tepsin T C 11: 119,984,508 (GRCm39) probably benign Het
Tmem40 G A 6: 115,710,946 (GRCm39) probably benign Het
Tpr G A 1: 150,283,165 (GRCm39) probably benign Het
Ttll12 A T 15: 83,464,859 (GRCm39) probably benign Het
Ttn T A 2: 76,739,952 (GRCm39) D3529V probably benign Het
Usp34 T A 11: 23,283,838 (GRCm39) H177Q possibly damaging Het
Vsig10 T A 5: 117,476,526 (GRCm39) S327T probably benign Het
Zbtb4 T A 11: 69,668,465 (GRCm39) M396K probably damaging Het
Zfp352 C T 4: 90,113,246 (GRCm39) T462I possibly damaging Het
Zfp385b T C 2: 77,307,189 (GRCm39) M145V probably damaging Het
Zfp780b C A 7: 27,671,114 (GRCm39) V65F possibly damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52,070,986 (GRCm39) missense probably benign 0.01
IGL00338:Ros1 APN 10 52,001,907 (GRCm39) missense probably benign
IGL00419:Ros1 APN 10 51,967,150 (GRCm39) missense probably damaging 0.97
IGL00840:Ros1 APN 10 52,020,969 (GRCm39) missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52,020,969 (GRCm39) missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52,019,348 (GRCm39) missense probably damaging 0.99
IGL01123:Ros1 APN 10 51,996,905 (GRCm39) missense probably damaging 1.00
IGL01128:Ros1 APN 10 52,018,424 (GRCm39) nonsense probably null
IGL01300:Ros1 APN 10 51,977,809 (GRCm39) missense probably benign 0.01
IGL01316:Ros1 APN 10 51,963,975 (GRCm39) critical splice donor site probably null
IGL01349:Ros1 APN 10 51,927,122 (GRCm39) missense probably damaging 0.99
IGL01363:Ros1 APN 10 52,042,238 (GRCm39) missense probably damaging 1.00
IGL01457:Ros1 APN 10 51,922,426 (GRCm39) splice site probably benign
IGL01532:Ros1 APN 10 51,967,034 (GRCm39) splice site probably benign
IGL01585:Ros1 APN 10 52,031,198 (GRCm39) missense probably damaging 1.00
IGL01650:Ros1 APN 10 52,031,075 (GRCm39) missense probably damaging 0.99
IGL01672:Ros1 APN 10 51,977,899 (GRCm39) missense possibly damaging 0.92
IGL01904:Ros1 APN 10 51,954,007 (GRCm39) missense probably damaging 0.97
IGL02040:Ros1 APN 10 51,992,018 (GRCm39) missense probably damaging 0.99
IGL02053:Ros1 APN 10 52,038,816 (GRCm39) missense probably damaging 1.00
IGL02147:Ros1 APN 10 51,996,991 (GRCm39) missense probably damaging 1.00
IGL02169:Ros1 APN 10 51,958,053 (GRCm39) critical splice donor site probably null
IGL02247:Ros1 APN 10 52,005,677 (GRCm39) missense probably damaging 0.99
IGL02262:Ros1 APN 10 52,055,065 (GRCm39) missense probably damaging 0.96
IGL02307:Ros1 APN 10 52,004,534 (GRCm39) missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52,020,980 (GRCm39) splice site probably benign
IGL02525:Ros1 APN 10 51,992,138 (GRCm39) missense possibly damaging 0.66
IGL02718:Ros1 APN 10 51,994,328 (GRCm39) missense probably damaging 1.00
IGL02721:Ros1 APN 10 52,048,927 (GRCm39) splice site probably benign
IGL02808:Ros1 APN 10 52,001,985 (GRCm39) missense probably damaging 1.00
IGL03009:Ros1 APN 10 52,022,003 (GRCm39) missense probably benign 0.00
IGL03035:Ros1 APN 10 51,952,080 (GRCm39) splice site probably benign
IGL03092:Ros1 APN 10 51,974,902 (GRCm39) missense probably damaging 0.99
IGL03309:Ros1 APN 10 51,994,357 (GRCm39) missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52,031,267 (GRCm39) missense probably damaging 1.00
boss UTSW 10 51,967,091 (GRCm39) nonsense probably null
Chuckwagon UTSW 10 51,994,299 (GRCm39) missense probably damaging 1.00
R1005_Ros1_648 UTSW 10 52,004,501 (GRCm39) splice site probably benign
R1220_Ros1_012 UTSW 10 51,974,966 (GRCm39) missense probably damaging 0.97
R3423_Ros1_122 UTSW 10 52,004,512 (GRCm39) splice site probably null
trail UTSW 10 52,037,991 (GRCm39) nonsense probably null
R0049:Ros1 UTSW 10 51,977,857 (GRCm39) missense possibly damaging 0.66
R0049:Ros1 UTSW 10 51,977,857 (GRCm39) missense possibly damaging 0.66
R0050:Ros1 UTSW 10 51,977,899 (GRCm39) missense probably damaging 0.97
R0050:Ros1 UTSW 10 51,977,899 (GRCm39) missense probably damaging 0.97
R0057:Ros1 UTSW 10 52,056,287 (GRCm39) missense probably benign 0.00
R0057:Ros1 UTSW 10 52,056,287 (GRCm39) missense probably benign 0.00
R0106:Ros1 UTSW 10 52,018,363 (GRCm39) missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52,018,363 (GRCm39) missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52,001,885 (GRCm39) missense probably benign 0.38
R0487:Ros1 UTSW 10 52,031,204 (GRCm39) missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52,070,919 (GRCm39) splice site probably benign
R0557:Ros1 UTSW 10 51,961,359 (GRCm39) missense possibly damaging 0.82
R0599:Ros1 UTSW 10 51,999,396 (GRCm39) missense probably damaging 1.00
R0620:Ros1 UTSW 10 51,994,444 (GRCm39) missense probably damaging 1.00
R0679:Ros1 UTSW 10 51,942,391 (GRCm39) missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52,004,501 (GRCm39) splice site probably benign
R1073:Ros1 UTSW 10 51,922,221 (GRCm39) missense probably damaging 1.00
R1220:Ros1 UTSW 10 51,974,966 (GRCm39) missense probably damaging 0.97
R1279:Ros1 UTSW 10 52,018,262 (GRCm39) missense possibly damaging 0.81
R1295:Ros1 UTSW 10 51,964,028 (GRCm39) missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52,044,758 (GRCm39) missense probably damaging 1.00
R1371:Ros1 UTSW 10 51,964,041 (GRCm39) missense probably damaging 0.98
R1447:Ros1 UTSW 10 51,974,954 (GRCm39) missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52,048,954 (GRCm39) missense probably damaging 1.00
R1499:Ros1 UTSW 10 51,974,773 (GRCm39) missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52,037,907 (GRCm39) missense probably damaging 1.00
R1744:Ros1 UTSW 10 51,999,475 (GRCm39) missense probably damaging 0.99
R1759:Ros1 UTSW 10 51,996,922 (GRCm39) missense probably damaging 1.00
R1791:Ros1 UTSW 10 51,976,183 (GRCm39) missense probably benign 0.00
R1794:Ros1 UTSW 10 52,000,199 (GRCm39) nonsense probably null
R2031:Ros1 UTSW 10 51,943,164 (GRCm39) missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52,004,651 (GRCm39) missense probably benign 0.00
R2219:Ros1 UTSW 10 52,042,175 (GRCm39) missense probably damaging 1.00
R2290:Ros1 UTSW 10 51,994,477 (GRCm39) missense probably damaging 0.96
R2329:Ros1 UTSW 10 52,038,983 (GRCm39) missense probably damaging 1.00
R2371:Ros1 UTSW 10 52,039,991 (GRCm39) missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52,048,936 (GRCm39) critical splice donor site probably null
R3154:Ros1 UTSW 10 51,927,077 (GRCm39) missense probably benign
R3423:Ros1 UTSW 10 52,004,512 (GRCm39) splice site probably null
R3424:Ros1 UTSW 10 52,004,512 (GRCm39) splice site probably null
R3425:Ros1 UTSW 10 52,004,512 (GRCm39) splice site probably null
R3433:Ros1 UTSW 10 51,967,204 (GRCm39) missense probably benign 0.45
R3522:Ros1 UTSW 10 51,967,091 (GRCm39) nonsense probably null
R3686:Ros1 UTSW 10 52,021,912 (GRCm39) missense probably damaging 1.00
R3710:Ros1 UTSW 10 52,037,991 (GRCm39) nonsense probably null
R3771:Ros1 UTSW 10 52,005,087 (GRCm39) missense probably damaging 0.97
R3808:Ros1 UTSW 10 51,996,944 (GRCm39) missense probably benign 0.08
R3930:Ros1 UTSW 10 52,070,944 (GRCm39) missense possibly damaging 0.92
R3950:Ros1 UTSW 10 51,942,484 (GRCm39) missense probably damaging 1.00
R3981:Ros1 UTSW 10 51,996,974 (GRCm39) missense possibly damaging 0.46
R4007:Ros1 UTSW 10 51,994,328 (GRCm39) missense probably damaging 1.00
R4346:Ros1 UTSW 10 52,044,705 (GRCm39) missense possibly damaging 0.92
R4382:Ros1 UTSW 10 51,997,055 (GRCm39) missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52,038,800 (GRCm39) critical splice donor site probably null
R4450:Ros1 UTSW 10 51,954,038 (GRCm39) missense probably damaging 0.98
R4468:Ros1 UTSW 10 51,994,452 (GRCm39) missense probably damaging 1.00
R4569:Ros1 UTSW 10 52,040,090 (GRCm39) missense probably damaging 0.99
R4649:Ros1 UTSW 10 52,005,764 (GRCm39) missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52,005,192 (GRCm39) missense probably damaging 1.00
R4706:Ros1 UTSW 10 51,977,990 (GRCm39) missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52,018,325 (GRCm39) missense probably damaging 1.00
R4748:Ros1 UTSW 10 51,992,093 (GRCm39) missense probably benign 0.00
R4806:Ros1 UTSW 10 51,972,271 (GRCm39) missense probably damaging 0.96
R4865:Ros1 UTSW 10 52,048,966 (GRCm39) missense probably damaging 0.99
R4973:Ros1 UTSW 10 52,031,087 (GRCm39) missense probably damaging 0.98
R5022:Ros1 UTSW 10 52,000,171 (GRCm39) missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52,004,512 (GRCm39) critical splice donor site probably null
R5082:Ros1 UTSW 10 52,040,037 (GRCm39) missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52,040,037 (GRCm39) missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52,040,037 (GRCm39) missense possibly damaging 0.66
R5269:Ros1 UTSW 10 51,927,104 (GRCm39) missense probably damaging 1.00
R5399:Ros1 UTSW 10 51,967,040 (GRCm39) critical splice donor site probably null
R5414:Ros1 UTSW 10 52,031,189 (GRCm39) missense probably damaging 1.00
R5659:Ros1 UTSW 10 52,019,482 (GRCm39) missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52,018,234 (GRCm39) critical splice donor site probably null
R5780:Ros1 UTSW 10 52,070,953 (GRCm39) missense probably damaging 1.00
R5805:Ros1 UTSW 10 51,999,385 (GRCm39) missense probably damaging 1.00
R5843:Ros1 UTSW 10 52,042,293 (GRCm39) missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52,057,894 (GRCm39) missense probably benign 0.26
R6027:Ros1 UTSW 10 52,040,064 (GRCm39) missense possibly damaging 0.82
R6035:Ros1 UTSW 10 51,954,067 (GRCm39) missense probably benign
R6035:Ros1 UTSW 10 51,954,067 (GRCm39) missense probably benign
R6052:Ros1 UTSW 10 52,039,999 (GRCm39) missense probably benign 0.39
R6175:Ros1 UTSW 10 51,977,881 (GRCm39) missense probably benign 0.02
R6315:Ros1 UTSW 10 51,994,306 (GRCm39) missense probably benign
R6342:Ros1 UTSW 10 52,031,351 (GRCm39) missense probably damaging 1.00
R6470:Ros1 UTSW 10 52,042,140 (GRCm39) critical splice donor site probably null
R6527:Ros1 UTSW 10 52,019,473 (GRCm39) missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52,038,908 (GRCm39) missense probably damaging 1.00
R6573:Ros1 UTSW 10 52,031,106 (GRCm39) missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52,018,299 (GRCm39) missense probably damaging 1.00
R6959:Ros1 UTSW 10 52,040,090 (GRCm39) missense probably damaging 0.99
R7011:Ros1 UTSW 10 52,056,272 (GRCm39) missense probably damaging 1.00
R7111:Ros1 UTSW 10 52,057,906 (GRCm39) missense probably benign 0.02
R7243:Ros1 UTSW 10 51,999,477 (GRCm39) missense probably damaging 1.00
R7355:Ros1 UTSW 10 52,042,175 (GRCm39) missense probably damaging 1.00
R7385:Ros1 UTSW 10 52,031,222 (GRCm39) missense probably benign 0.00
R7460:Ros1 UTSW 10 51,994,299 (GRCm39) missense probably damaging 1.00
R7549:Ros1 UTSW 10 52,021,930 (GRCm39) missense probably damaging 0.96
R7573:Ros1 UTSW 10 52,046,072 (GRCm39) missense probably benign 0.03
R7650:Ros1 UTSW 10 51,922,305 (GRCm39) missense probably benign 0.00
R7667:Ros1 UTSW 10 52,040,067 (GRCm39) missense probably damaging 1.00
R7696:Ros1 UTSW 10 52,018,379 (GRCm39) missense probably damaging 1.00
R7785:Ros1 UTSW 10 52,038,944 (GRCm39) missense probably damaging 1.00
R7814:Ros1 UTSW 10 51,972,233 (GRCm39) missense probably benign 0.28
R7830:Ros1 UTSW 10 52,031,030 (GRCm39) missense probably damaging 0.99
R7832:Ros1 UTSW 10 52,020,957 (GRCm39) missense probably damaging 0.99
R7854:Ros1 UTSW 10 52,004,563 (GRCm39) missense probably damaging 1.00
R7912:Ros1 UTSW 10 52,044,791 (GRCm39) missense probably damaging 1.00
R7972:Ros1 UTSW 10 52,030,926 (GRCm39) nonsense probably null
R7993:Ros1 UTSW 10 51,999,443 (GRCm39) missense probably benign 0.34
R8036:Ros1 UTSW 10 52,041,439 (GRCm39) missense probably benign
R8137:Ros1 UTSW 10 52,001,933 (GRCm39) missense possibly damaging 0.87
R8169:Ros1 UTSW 10 51,940,768 (GRCm39) critical splice donor site probably null
R8199:Ros1 UTSW 10 51,977,813 (GRCm39) nonsense probably null
R8293:Ros1 UTSW 10 51,964,014 (GRCm39) missense probably damaging 1.00
R8368:Ros1 UTSW 10 51,940,833 (GRCm39) missense probably damaging 1.00
R8406:Ros1 UTSW 10 51,977,941 (GRCm39) missense possibly damaging 0.56
R8471:Ros1 UTSW 10 51,997,078 (GRCm39) missense probably benign 0.00
R8498:Ros1 UTSW 10 52,055,047 (GRCm39) missense probably damaging 0.99
R8532:Ros1 UTSW 10 51,974,852 (GRCm39) missense possibly damaging 0.92
R8678:Ros1 UTSW 10 51,963,998 (GRCm39) missense probably benign
R8726:Ros1 UTSW 10 51,954,769 (GRCm39) missense possibly damaging 0.46
R8789:Ros1 UTSW 10 51,999,328 (GRCm39) missense probably damaging 0.99
R8799:Ros1 UTSW 10 51,922,143 (GRCm39) missense probably benign 0.08
R8915:Ros1 UTSW 10 51,977,805 (GRCm39) splice site probably benign
R8958:Ros1 UTSW 10 51,972,190 (GRCm39) missense probably damaging 1.00
R8972:Ros1 UTSW 10 51,999,333 (GRCm39) missense probably benign 0.05
R9020:Ros1 UTSW 10 52,031,023 (GRCm39) missense probably benign 0.32
R9147:Ros1 UTSW 10 51,927,039 (GRCm39) missense probably benign
R9154:Ros1 UTSW 10 51,922,301 (GRCm39) missense possibly damaging 0.87
R9189:Ros1 UTSW 10 52,019,502 (GRCm39) missense probably damaging 0.99
R9341:Ros1 UTSW 10 51,972,116 (GRCm39) critical splice donor site probably null
R9343:Ros1 UTSW 10 51,972,116 (GRCm39) critical splice donor site probably null
R9407:Ros1 UTSW 10 51,994,491 (GRCm39) missense probably damaging 1.00
R9428:Ros1 UTSW 10 51,958,061 (GRCm39) missense probably benign 0.00
R9502:Ros1 UTSW 10 52,000,174 (GRCm39) missense probably benign 0.00
R9531:Ros1 UTSW 10 52,007,063 (GRCm39) missense probably damaging 1.00
R9546:Ros1 UTSW 10 51,994,215 (GRCm39) critical splice donor site probably null
R9562:Ros1 UTSW 10 51,943,170 (GRCm39) missense probably damaging 1.00
R9565:Ros1 UTSW 10 51,943,170 (GRCm39) missense probably damaging 1.00
R9604:Ros1 UTSW 10 51,994,249 (GRCm39) missense probably damaging 1.00
R9645:Ros1 UTSW 10 51,948,148 (GRCm39) critical splice donor site probably null
R9658:Ros1 UTSW 10 51,967,069 (GRCm39) missense probably damaging 0.99
R9664:Ros1 UTSW 10 51,996,931 (GRCm39) missense probably benign 0.18
RF018:Ros1 UTSW 10 52,031,217 (GRCm39) missense probably benign
Z1176:Ros1 UTSW 10 51,967,205 (GRCm39) missense possibly damaging 0.89
Z1177:Ros1 UTSW 10 52,044,767 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCAGCCCAGTAGAGAAAGTGAC -3'
(R):5'- CACCCAACAGTGAGCTGGACTAAG -3'

Sequencing Primer
(F):5'- GTGACCCAGCCATTCAAAGG -3'
(R):5'- gccatataactgcctctgcc -3'
Posted On 2013-05-09