Mutagenetix > Incidental Mutation

Incidental Mutation 'R4747:Cnot1'

357195

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

042029-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4747 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95774682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 86 (N86S)

Ref Sequence

ENSEMBL: ENSMUSP00000148574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: N86S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: N86S

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: N86S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: N86S

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: N84S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

probably benign
Transcript: ENSMUST00000212323
AA Change: N86S

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212863

Predicted Effect

probably benign
Transcript: ENSMUST00000213006
AA Change: N86S

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,326,894	E479D	probably damaging	Het
4933402D24Rik	A	G	1: 63,756,409		probably benign	Het
Acadvl	G	T	11: 70,012,508	N340K	probably damaging	Het
Adgrl4	T	A	3: 151,507,440	N372K	probably benign	Het
Adh1	G	A	3: 138,288,881	G321S	probably damaging	Het
Ankrd26	G	T	6: 118,527,757	N730K	probably benign	Het
Aoc2	A	T	11: 101,328,820		probably null	Het
Arhgef4	A	G	1: 34,723,274	E537G	unknown	Het
Ccdc7b	T	C	8: 129,178,235	V118A	probably benign	Het
Ccdc88b	T	A	19: 6,856,141	R219W	probably damaging	Het
Ccdc97	T	C	7: 25,718,923		probably null	Het
Comp	T	C	8: 70,376,702	C310R	probably damaging	Het
Crtc2	A	T	3: 90,260,211	N281Y	probably damaging	Het
Cryl1	T	C	14: 57,313,102	K102E	probably damaging	Het
Csf2ra	G	A	19: 61,226,053	R225*	probably null	Het
Dao	A	T	5: 114,012,632	D99V	probably benign	Het
Dgkd	A	G	1: 87,934,167	T815A	probably damaging	Het
Dhrs7	T	C	12: 72,653,118	T247A	probably benign	Het
Dnah7c	G	C	1: 46,533,168	D934H	probably damaging	Het
Dnajc15	T	C	14: 77,844,456	Y82C	probably benign	Het
Dnajc4	T	C	19: 6,989,504	Q152R	probably damaging	Het
Dsc1	T	C	18: 20,094,558	K541R	probably damaging	Het
Elp4	G	A	2: 105,794,607	R196C	probably damaging	Het
Epha8	GC	G	4: 136,938,695		probably null	Het
Ercc6	T	C	14: 32,569,907	V1076A	probably benign	Het
Fgd4	T	C	16: 16,423,929	Y677C	probably damaging	Het
Fndc3b	C	A	3: 27,428,965	C1028F	probably damaging	Het
Folr1	T	A	7: 101,863,977	D37V	probably damaging	Het
Gabrr3	T	A	16: 59,447,914		probably null	Het
Garem1	C	A	18: 21,129,943	V605L	probably benign	Het
Gbp7	A	T	3: 142,543,017	D347V	probably damaging	Het
Gdpd4	A	G	7: 97,961,633	T87A	possibly damaging	Het
Gm12258	C	A	11: 58,859,596	H532Q	probably damaging	Het
Gm4788	A	T	1: 139,698,184	C792S	probably damaging	Het
Herc2	A	G	7: 56,106,393	E727G	possibly damaging	Het
Hfm1	G	A	5: 106,917,523	H97Y	probably benign	Het
Idua	G	T	5: 108,681,036	R335L	probably damaging	Het
Ifi207	A	G	1: 173,729,067	S702P	probably benign	Het
Kif16b	A	T	2: 142,857,426	V78D	probably damaging	Het
Klra17	T	A	6: 129,872,269	D114V	probably damaging	Het
Krt76	A	G	15: 101,885,745	S481P	probably damaging	Het
Lhfpl5	A	G	17: 28,579,976	D153G	probably damaging	Het
Med21	T	A	6: 146,649,202	D70E	possibly damaging	Het
Mroh3	A	T	1: 136,185,499	M739K	probably benign	Het
Myo1a	A	G	10: 127,714,438	E549G	probably damaging	Het
Narfl	A	T	17: 25,780,353	Y247F	probably benign	Het
Neu1	A	G	17: 34,934,383	D294G	possibly damaging	Het
Nmur2	A	T	11: 56,040,279	I202K	probably benign	Het
Nop2	T	A	6: 125,137,094	D174E	probably benign	Het
Ogfr	A	T	2: 180,594,423	H267L	probably damaging	Het
Olfr1031	A	G	2: 85,991,927	T37A	probably damaging	Het
Olfr796	G	T	10: 129,608,184	A99E	possibly damaging	Het
P2ry13	T	A	3: 59,209,887	I157F	probably benign	Het
Pank4	T	C	4: 154,979,532	V660A	probably damaging	Het
Pax6	C	A	2: 105,696,502	P251Q	probably benign	Het
Pcdhb13	T	C	18: 37,444,815	Y749H	probably damaging	Het
Pcdhga3	C	A	18: 37,676,746	Q751K	probably benign	Het
Pcnt	C	T	10: 76,436,465	E186K	possibly damaging	Het
Pecam1	A	T	11: 106,684,246	F613I	probably benign	Het
Pias2	T	C	18: 77,152,792	*615Q	probably null	Het
Plb1	A	T	5: 32,349,659	M1193L	probably benign	Het
Pomgnt1	T	C	4: 116,156,199	L506P	probably damaging	Het
Qrfp	T	C	2: 31,808,840	T27A	probably damaging	Het
Relb	C	A	7: 19,627,922		probably null	Het
Rgl1	G	T	1: 152,524,699	C685*	probably null	Het
Ric8b	A	G	10: 84,917,764	Y8C	probably benign	Het
Rrp36	G	A	17: 46,669,967	A161V	possibly damaging	Het
Samd9l	G	A	6: 3,375,504	Q586*	probably null	Het
Sbf1	C	T	15: 89,302,713	D821N	probably damaging	Het
Sept8	G	C	11: 53,536,718	A255P	probably damaging	Het
Skp2	T	C	15: 9,113,839	T329A	possibly damaging	Het
Slc15a2	C	T	16: 36,772,136	V220M	probably damaging	Het
Slc25a11	T	A	11: 70,645,956	T63S	possibly damaging	Het
Sowahc	T	C	10: 59,223,161	I373T	probably benign	Het
Sptbn2	T	A	19: 4,748,154	M1969K	probably benign	Het
St14	G	A	9: 31,103,757	T315M	possibly damaging	Het
Tagap	G	A	17: 7,932,198	R284H	probably benign	Het
Tdpoz3	T	A	3: 93,826,169	S50R	possibly damaging	Het
Thoc5	A	G	11: 4,904,187	D182G	probably damaging	Het
Tinag	A	G	9: 76,996,956	V395A	probably benign	Het
Tmc8	A	G	11: 117,792,724	S702G	probably benign	Het
Tmem202	A	G	9: 59,519,194	S230P	possibly damaging	Het
Tmem203	T	C	2: 25,255,752	V28A	probably benign	Het
Traf3ip1	A	T	1: 91,527,757	S647C	probably damaging	Het
Tram1	A	T	1: 13,589,646	I26N	probably damaging	Het
Ttc6	A	T	12: 57,674,692	D989V	possibly damaging	Het
Ttll6	A	G	11: 96,145,546	T334A	possibly damaging	Het
Ttn	A	T	2: 76,919,742	D3654E	probably damaging	Het
Ufd1	T	G	16: 18,821,082	V112G	probably damaging	Het
Usp9y	A	T	Y: 1,391,284	Y629N	possibly damaging	Het
Vmn2r1	A	G	3: 64,081,846	I69V	probably benign	Het
Zfp180	A	T	7: 24,105,821	Y555F	probably damaging	Het
Zfp438	T	C	18: 5,214,403	N185S	probably benign	Het
Zfp445	C	T	9: 122,857,150	V15I	possibly damaging	Het
Zfp462	A	G	4: 55,013,476	E1814G	probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GTTACATATCTACAACAGCCCGG -3'
(R):5'- CTGAACGGAATCTCTTTGGCTTG -3'

Sequencing Primer
(F):5'- TATCTACAACAGCCCGGCACTG -3'
(R):5'- GGTGTTGCTGATAGGTTTTATATACC -3'

Posted On

2015-11-11