Incidental Mutation 'R4747:Ercc6'
ID357219
Institutional Source Beutler Lab
Gene Symbol Ercc6
Ensembl Gene ENSMUSG00000054051
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6
SynonymsCS group B correcting gene, C130058G22Rik, CSB
MMRRC Submission 042029-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R4747 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32513521-32580990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32569907 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1076 (V1076A)
Ref Sequence ENSEMBL: ENSMUSP00000066256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066807]
Predicted Effect probably benign
Transcript: ENSMUST00000066807
AA Change: V1076A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: V1076A

DomainStartEndE-ValueType
PDB:4CVO|A 82 160 1e-36 PDB
low complexity region 286 299 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 460 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
DEXDc 499 699 8.34e-33 SMART
Blast:DEXDc 720 821 7e-56 BLAST
HELICc 865 948 1.41e-21 SMART
low complexity region 1364 1377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228549
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,894 E479D probably damaging Het
4933402D24Rik A G 1: 63,756,409 probably benign Het
Acadvl G T 11: 70,012,508 N340K probably damaging Het
Adgrl4 T A 3: 151,507,440 N372K probably benign Het
Adh1 G A 3: 138,288,881 G321S probably damaging Het
Ankrd26 G T 6: 118,527,757 N730K probably benign Het
Aoc2 A T 11: 101,328,820 probably null Het
Arhgef4 A G 1: 34,723,274 E537G unknown Het
Ccdc7b T C 8: 129,178,235 V118A probably benign Het
Ccdc88b T A 19: 6,856,141 R219W probably damaging Het
Ccdc97 T C 7: 25,718,923 probably null Het
Cnot1 T C 8: 95,774,682 N86S probably benign Het
Comp T C 8: 70,376,702 C310R probably damaging Het
Crtc2 A T 3: 90,260,211 N281Y probably damaging Het
Cryl1 T C 14: 57,313,102 K102E probably damaging Het
Csf2ra G A 19: 61,226,053 R225* probably null Het
Dao A T 5: 114,012,632 D99V probably benign Het
Dgkd A G 1: 87,934,167 T815A probably damaging Het
Dhrs7 T C 12: 72,653,118 T247A probably benign Het
Dnah7c G C 1: 46,533,168 D934H probably damaging Het
Dnajc15 T C 14: 77,844,456 Y82C probably benign Het
Dnajc4 T C 19: 6,989,504 Q152R probably damaging Het
Dsc1 T C 18: 20,094,558 K541R probably damaging Het
Elp4 G A 2: 105,794,607 R196C probably damaging Het
Epha8 GC G 4: 136,938,695 probably null Het
Fgd4 T C 16: 16,423,929 Y677C probably damaging Het
Fndc3b C A 3: 27,428,965 C1028F probably damaging Het
Folr1 T A 7: 101,863,977 D37V probably damaging Het
Gabrr3 T A 16: 59,447,914 probably null Het
Garem1 C A 18: 21,129,943 V605L probably benign Het
Gbp7 A T 3: 142,543,017 D347V probably damaging Het
Gdpd4 A G 7: 97,961,633 T87A possibly damaging Het
Gm12258 C A 11: 58,859,596 H532Q probably damaging Het
Gm4788 A T 1: 139,698,184 C792S probably damaging Het
Herc2 A G 7: 56,106,393 E727G possibly damaging Het
Hfm1 G A 5: 106,917,523 H97Y probably benign Het
Idua G T 5: 108,681,036 R335L probably damaging Het
Ifi207 A G 1: 173,729,067 S702P probably benign Het
Kif16b A T 2: 142,857,426 V78D probably damaging Het
Klra17 T A 6: 129,872,269 D114V probably damaging Het
Krt76 A G 15: 101,885,745 S481P probably damaging Het
Lhfpl5 A G 17: 28,579,976 D153G probably damaging Het
Med21 T A 6: 146,649,202 D70E possibly damaging Het
Mroh3 A T 1: 136,185,499 M739K probably benign Het
Myo1a A G 10: 127,714,438 E549G probably damaging Het
Narfl A T 17: 25,780,353 Y247F probably benign Het
Neu1 A G 17: 34,934,383 D294G possibly damaging Het
Nmur2 A T 11: 56,040,279 I202K probably benign Het
Nop2 T A 6: 125,137,094 D174E probably benign Het
Ogfr A T 2: 180,594,423 H267L probably damaging Het
Olfr1031 A G 2: 85,991,927 T37A probably damaging Het
Olfr796 G T 10: 129,608,184 A99E possibly damaging Het
P2ry13 T A 3: 59,209,887 I157F probably benign Het
Pank4 T C 4: 154,979,532 V660A probably damaging Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pcdhb13 T C 18: 37,444,815 Y749H probably damaging Het
Pcdhga3 C A 18: 37,676,746 Q751K probably benign Het
Pcnt C T 10: 76,436,465 E186K possibly damaging Het
Pecam1 A T 11: 106,684,246 F613I probably benign Het
Pias2 T C 18: 77,152,792 *615Q probably null Het
Plb1 A T 5: 32,349,659 M1193L probably benign Het
Pomgnt1 T C 4: 116,156,199 L506P probably damaging Het
Qrfp T C 2: 31,808,840 T27A probably damaging Het
Relb C A 7: 19,627,922 probably null Het
Rgl1 G T 1: 152,524,699 C685* probably null Het
Ric8b A G 10: 84,917,764 Y8C probably benign Het
Rrp36 G A 17: 46,669,967 A161V possibly damaging Het
Samd9l G A 6: 3,375,504 Q586* probably null Het
Sbf1 C T 15: 89,302,713 D821N probably damaging Het
Sept8 G C 11: 53,536,718 A255P probably damaging Het
Skp2 T C 15: 9,113,839 T329A possibly damaging Het
Slc15a2 C T 16: 36,772,136 V220M probably damaging Het
Slc25a11 T A 11: 70,645,956 T63S possibly damaging Het
Sowahc T C 10: 59,223,161 I373T probably benign Het
Sptbn2 T A 19: 4,748,154 M1969K probably benign Het
St14 G A 9: 31,103,757 T315M possibly damaging Het
Tagap G A 17: 7,932,198 R284H probably benign Het
Tdpoz3 T A 3: 93,826,169 S50R possibly damaging Het
Thoc5 A G 11: 4,904,187 D182G probably damaging Het
Tinag A G 9: 76,996,956 V395A probably benign Het
Tmc8 A G 11: 117,792,724 S702G probably benign Het
Tmem202 A G 9: 59,519,194 S230P possibly damaging Het
Tmem203 T C 2: 25,255,752 V28A probably benign Het
Traf3ip1 A T 1: 91,527,757 S647C probably damaging Het
Tram1 A T 1: 13,589,646 I26N probably damaging Het
Ttc6 A T 12: 57,674,692 D989V possibly damaging Het
Ttll6 A G 11: 96,145,546 T334A possibly damaging Het
Ttn A T 2: 76,919,742 D3654E probably damaging Het
Ufd1 T G 16: 18,821,082 V112G probably damaging Het
Usp9y A T Y: 1,391,284 Y629N possibly damaging Het
Vmn2r1 A G 3: 64,081,846 I69V probably benign Het
Zfp180 A T 7: 24,105,821 Y555F probably damaging Het
Zfp438 T C 18: 5,214,403 N185S probably benign Het
Zfp445 C T 9: 122,857,150 V15I possibly damaging Het
Zfp462 A G 4: 55,013,476 E1814G probably benign Het
Other mutations in Ercc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ercc6 APN 14 32568072 missense probably damaging 1.00
IGL00796:Ercc6 APN 14 32570002 missense probably benign 0.01
IGL00916:Ercc6 APN 14 32562655 intron probably benign
IGL01743:Ercc6 APN 14 32552604 missense probably damaging 1.00
IGL01802:Ercc6 APN 14 32562574 missense probably damaging 0.99
IGL01886:Ercc6 APN 14 32569580 missense possibly damaging 0.90
IGL02100:Ercc6 APN 14 32517095 missense probably benign 0.00
IGL02115:Ercc6 APN 14 32576993 missense probably damaging 1.00
IGL02755:Ercc6 APN 14 32575748 splice site probably benign
IGL02964:Ercc6 APN 14 32570103 missense probably benign 0.00
IGL02998:Ercc6 APN 14 32557857 missense probably benign 0.05
IGL03150:Ercc6 APN 14 32558574 missense probably damaging 0.96
R0152:Ercc6 UTSW 14 32546905 critical splice donor site probably benign
R0519:Ercc6 UTSW 14 32526842 missense probably damaging 1.00
R0591:Ercc6 UTSW 14 32558016 splice site probably benign
R0894:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R0946:Ercc6 UTSW 14 32552621 missense probably benign 0.08
R1313:Ercc6 UTSW 14 32552720 splice site probably benign
R1506:Ercc6 UTSW 14 32569864 missense probably benign 0.01
R1528:Ercc6 UTSW 14 32519022 missense probably damaging 0.98
R1711:Ercc6 UTSW 14 32526176 missense probably damaging 1.00
R1753:Ercc6 UTSW 14 32576999 missense probably benign
R1795:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R1843:Ercc6 UTSW 14 32546820 missense probably damaging 0.99
R1853:Ercc6 UTSW 14 32576816 missense possibly damaging 0.86
R1859:Ercc6 UTSW 14 32526778 missense probably damaging 1.00
R1912:Ercc6 UTSW 14 32576803 missense probably damaging 1.00
R2308:Ercc6 UTSW 14 32566409 missense possibly damaging 0.70
R2322:Ercc6 UTSW 14 32526317 missense probably damaging 1.00
R2386:Ercc6 UTSW 14 32541359 splice site probably null
R4170:Ercc6 UTSW 14 32566797 missense probably damaging 1.00
R4369:Ercc6 UTSW 14 32517207 missense probably damaging 0.96
R4389:Ercc6 UTSW 14 32574908 nonsense probably null
R4811:Ercc6 UTSW 14 32574929 missense probably benign 0.20
R4840:Ercc6 UTSW 14 32541296 missense probably damaging 1.00
R4973:Ercc6 UTSW 14 32574902 missense probably damaging 1.00
R5068:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5069:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5070:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5093:Ercc6 UTSW 14 32567522 missense probably damaging 1.00
R5265:Ercc6 UTSW 14 32569623 missense probably benign 0.01
R5272:Ercc6 UTSW 14 32519028 nonsense probably null
R5499:Ercc6 UTSW 14 32516959 start codon destroyed probably null 0.98
R5795:Ercc6 UTSW 14 32526352 missense probably damaging 0.98
R6258:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6260:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6267:Ercc6 UTSW 14 32526403 nonsense probably null
R6291:Ercc6 UTSW 14 32569986 missense probably benign 0.01
R6296:Ercc6 UTSW 14 32526403 nonsense probably null
R6361:Ercc6 UTSW 14 32517110 missense probably benign 0.00
R6500:Ercc6 UTSW 14 32526823 missense probably damaging 0.96
R6555:Ercc6 UTSW 14 32517107 missense probably benign 0.15
R6724:Ercc6 UTSW 14 32566331 missense probably benign 0.01
R6925:Ercc6 UTSW 14 32562608 missense probably damaging 0.99
R7143:Ercc6 UTSW 14 32570305 missense probably damaging 1.00
R7327:Ercc6 UTSW 14 32526404 missense probably benign 0.19
R7396:Ercc6 UTSW 14 32569805 missense probably benign 0.00
R7529:Ercc6 UTSW 14 32560729 nonsense probably null
R7609:Ercc6 UTSW 14 32566361 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCTGTGTTCTCCCTATTACAG -3'
(R):5'- AAGAACCCTGCTTCTCACTGG -3'

Sequencing Primer
(F):5'- TTACAGGAACGGGCTCCAGTATTC -3'
(R):5'- GTGCTTGCCTCCACTGGTG -3'
Posted On2015-11-11