Incidental Mutation 'R4748:Zc3h6'
ID 357262
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission 042030-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.168) question?
Stock # R4748 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 128844160 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 235 (G235R)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110320
AA Change: G235R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: G235R

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,784,394 (GRCm39) E54D possibly damaging Het
Abcb6 C A 1: 75,154,002 (GRCm39) G367W probably damaging Het
Asprv1 A G 6: 86,605,405 (GRCm39) M84V probably damaging Het
Aspscr1 T C 11: 120,592,333 (GRCm39) V291A probably damaging Het
B4galnt4 T C 7: 140,651,633 (GRCm39) F980L probably damaging Het
Bpi G A 2: 158,113,941 (GRCm39) V280I possibly damaging Het
Bptf T C 11: 106,986,706 (GRCm39) D581G probably damaging Het
Cap2 T A 13: 46,793,302 (GRCm39) Y223N possibly damaging Het
Ccdc141 A C 2: 76,888,324 (GRCm39) I480M possibly damaging Het
Ccn4 C A 15: 66,778,489 (GRCm39) Y103* probably null Het
Ccnh T A 13: 85,337,758 (GRCm39) V35E probably benign Het
Cd6 G T 19: 10,771,589 (GRCm39) S433* probably null Het
Ceacam10 A C 7: 24,480,477 (GRCm39) I83L probably benign Het
Chek2 T C 5: 111,003,705 (GRCm39) probably null Het
Chia1 A T 3: 106,029,765 (GRCm39) D73V probably damaging Het
Commd2 G A 3: 57,554,215 (GRCm39) T162I probably benign Het
Creb3l3 C T 10: 80,921,881 (GRCm39) A316T probably benign Het
Cul4a A G 8: 13,173,526 (GRCm39) K1R probably benign Het
Cyp2c23 T C 19: 44,005,176 (GRCm39) probably null Het
D630045J12Rik T C 6: 38,173,776 (GRCm39) T131A possibly damaging Het
Dctn4 A C 18: 60,683,308 (GRCm39) K295N probably damaging Het
Dnah1 A G 14: 31,041,902 (GRCm39) V23A probably benign Het
Dync1i1 A G 6: 5,767,048 (GRCm39) K91E possibly damaging Het
Dzip1l A G 9: 99,524,704 (GRCm39) D275G probably damaging Het
Enam C A 5: 88,649,402 (GRCm39) P304T probably damaging Het
Enpep A G 3: 129,125,812 (GRCm39) Y107H probably damaging Het
Exd2 T C 12: 80,527,350 (GRCm39) L27P probably damaging Het
Fam135b T A 15: 71,335,904 (GRCm39) D430V probably benign Het
Fam222b C T 11: 78,045,429 (GRCm39) T202I possibly damaging Het
Fmod T A 1: 133,968,912 (GRCm39) N317K probably damaging Het
Frem2 A G 3: 53,448,514 (GRCm39) F2301L probably damaging Het
Frem3 T C 8: 81,338,088 (GRCm39) F127S probably damaging Het
Gbp7 A G 3: 142,243,848 (GRCm39) S132G probably benign Het
Gm4787 A G 12: 81,424,830 (GRCm39) C443R probably damaging Het
Grik2 T C 10: 49,411,437 (GRCm39) M5V possibly damaging Het
Helb T C 10: 119,920,754 (GRCm39) D1063G probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt90 G A 15: 101,463,768 (GRCm39) L429F probably damaging Het
Lrr1 C A 12: 69,221,236 (GRCm39) T126K probably benign Het
Mgat4e C A 1: 134,469,766 (GRCm39) D93Y probably damaging Het
Mllt3 A T 4: 87,759,018 (GRCm39) S343R possibly damaging Het
Mms19 T A 19: 41,932,997 (GRCm39) S1031C probably damaging Het
Mtrf1 C T 14: 79,649,090 (GRCm39) H237Y probably damaging Het
Nckap1l T A 15: 103,381,483 (GRCm39) L408Q probably damaging Het
Oit3 A T 10: 59,259,904 (GRCm39) C500S probably damaging Het
Or11g1 T G 14: 50,651,333 (GRCm39) L111V possibly damaging Het
Or13c3 A G 4: 52,856,076 (GRCm39) S146P possibly damaging Het
Or4a39 C T 2: 89,236,599 (GRCm39) V275I probably benign Het
Or5d36 T A 2: 87,900,956 (GRCm39) I257L probably benign Het
Otud7a T C 7: 63,385,663 (GRCm39) S376P possibly damaging Het
Pabpc2 A T 18: 39,907,322 (GRCm39) K196* probably null Het
Paqr8 T A 1: 21,005,637 (GRCm39) C264S probably benign Het
Pgm1 T A 4: 99,839,176 (GRCm39) F459Y probably benign Het
Phip C A 9: 82,790,922 (GRCm39) V675L probably benign Het
Pnma1 T G 12: 84,194,497 (GRCm39) T69P probably benign Het
Ppp1r14bl T C 1: 23,140,951 (GRCm39) E121G probably damaging Het
Ptpn12 A T 5: 21,210,383 (GRCm39) C242* probably null Het
Rabep1 T A 11: 70,799,294 (GRCm39) V306E probably benign Het
Ros1 C T 10: 51,992,093 (GRCm39) D1377N probably benign Het
Ryr3 T C 2: 112,794,750 (GRCm39) T121A possibly damaging Het
Scaf11 G A 15: 96,318,302 (GRCm39) Q421* probably null Het
Shcbp1 G A 8: 4,794,512 (GRCm39) T427M probably damaging Het
Shprh G A 10: 11,046,220 (GRCm39) R979H probably damaging Het
Slc22a27 C T 19: 7,903,241 (GRCm39) C163Y probably benign Het
Slc27a1 A G 8: 72,033,319 (GRCm39) D287G probably damaging Het
Slc27a1 C T 8: 72,033,453 (GRCm39) T310M possibly damaging Het
Slc29a3 A G 10: 60,552,105 (GRCm39) V313A probably benign Het
Slc35f2 A T 9: 53,679,069 (GRCm39) M1L probably benign Het
Sltm G C 9: 70,488,647 (GRCm39) R599T probably damaging Het
Spic T A 10: 88,511,752 (GRCm39) Q168L probably damaging Het
Spink6 G A 18: 44,215,428 (GRCm39) probably null Het
Stac2 T C 11: 97,932,198 (GRCm39) E235G possibly damaging Het
Szt2 G A 4: 118,246,388 (GRCm39) Q957* probably null Het
Them7 A T 2: 105,208,991 (GRCm39) T104S possibly damaging Het
Tmed4 T A 11: 6,221,716 (GRCm39) I207F possibly damaging Het
Tmem248 A G 5: 130,265,731 (GRCm39) E178G probably benign Het
Tomm40l G A 1: 171,047,131 (GRCm39) R296* probably null Het
Trim80 C A 11: 115,338,964 (GRCm39) T598N possibly damaging Het
Trim9 T C 12: 70,295,047 (GRCm39) N688D probably damaging Het
Vil1 C T 1: 74,460,425 (GRCm39) A194V probably damaging Het
Vmn2r61 A T 7: 41,916,565 (GRCm39) M393L probably damaging Het
Vmn2r63 C T 7: 42,577,544 (GRCm39) M331I probably benign Het
Vps33b G T 7: 79,939,796 (GRCm39) A516S probably damaging Het
Zfp612 T A 8: 110,815,304 (GRCm39) D170E probably benign Het
Zfp746 A G 6: 48,041,490 (GRCm39) I412T probably benign Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 128,856,747 (GRCm39) missense probably benign 0.00
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 128,848,736 (GRCm39) missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1528:Zc3h6 UTSW 2 128,858,989 (GRCm39) missense probably benign 0.01
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 128,858,540 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 128,848,006 (GRCm39) missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 128,857,538 (GRCm39) missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128,835,372 (GRCm39) intron probably benign
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9076:Zc3h6 UTSW 2 128,859,096 (GRCm39) nonsense probably null
R9577:Zc3h6 UTSW 2 128,858,102 (GRCm39) missense
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTATTGGTTCTTTAAGCTAATAGACGT -3'
(R):5'- ACACATCCATTTTATCTTGAGGTTTT -3'

Sequencing Primer
(F):5'- GCTAATAGACGTTAGTTGCACTTAC -3'
(R):5'- ATCTTGAGGTTTTTCACATACACTC -3'
Posted On 2015-11-11