Incidental Mutation 'R4748:Chek2'
ID357280
Institutional Source Beutler Lab
Gene Symbol Chek2
Ensembl Gene ENSMUSG00000029521
Gene Namecheckpoint kinase 2
SynonymsRad53, CHK2
MMRRC Submission 042030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4748 (G1)
Quality Score200
Status Not validated
Chromosome5
Chromosomal Location110839979-110874145 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 110855839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066160] [ENSMUST00000199937]
Predicted Effect probably null
Transcript: ENSMUST00000066160
SMART Domains Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 5.14e-3 SMART
S_TKc 224 490 7.35e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199937
SMART Domains Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 2.6e-5 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutation of this gene does not increase tumor incidence. Cells from the thymus, central nervous system (CNS), hair follicles, and skin are resistant to ionizing radiation- and gamma irradiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,856,656 E54D possibly damaging Het
4933415F23Rik T C 1: 23,101,870 E121G probably damaging Het
Abcb6 C A 1: 75,177,358 G367W probably damaging Het
Asprv1 A G 6: 86,628,423 M84V probably damaging Het
Aspscr1 T C 11: 120,701,507 V291A probably damaging Het
B4galnt4 T C 7: 141,071,720 F980L probably damaging Het
Bpi G A 2: 158,272,021 V280I possibly damaging Het
Bptf T C 11: 107,095,880 D581G probably damaging Het
Cap2 T A 13: 46,639,826 Y223N possibly damaging Het
Ccdc141 A C 2: 77,057,980 I480M possibly damaging Het
Ccnh T A 13: 85,189,639 V35E probably benign Het
Cd6 G T 19: 10,794,225 S433* probably null Het
Ceacam10 A C 7: 24,781,052 I83L probably benign Het
Chia1 A T 3: 106,122,449 D73V probably damaging Het
Commd2 G A 3: 57,646,794 T162I probably benign Het
Creb3l3 C T 10: 81,086,047 A316T probably benign Het
Cul4a A G 8: 13,123,526 K1R probably benign Het
Cyp2c23 T C 19: 44,016,737 probably null Het
D630045J12Rik T C 6: 38,196,841 T131A possibly damaging Het
Dctn4 A C 18: 60,550,236 K295N probably damaging Het
Dnah1 A G 14: 31,319,945 V23A probably benign Het
Dync1i1 A G 6: 5,767,048 K91E possibly damaging Het
Dzip1l A G 9: 99,642,651 D275G probably damaging Het
Enam C A 5: 88,501,543 P304T probably damaging Het
Enpep A G 3: 129,332,163 Y107H probably damaging Het
Exd2 T C 12: 80,480,576 L27P probably damaging Het
Fam135b T A 15: 71,464,055 D430V probably benign Het
Fam222b C T 11: 78,154,603 T202I possibly damaging Het
Fmod T A 1: 134,041,174 N317K probably damaging Het
Frem2 A G 3: 53,541,093 F2301L probably damaging Het
Frem3 T C 8: 80,611,459 F127S probably damaging Het
Gbp7 A G 3: 142,538,087 S132G probably benign Het
Gm4787 A G 12: 81,378,056 C443R probably damaging Het
Grik2 T C 10: 49,535,341 M5V possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,555,333 L429F probably damaging Het
Lrr1 C A 12: 69,174,462 T126K probably benign Het
Mgat4e C A 1: 134,542,028 D93Y probably damaging Het
Mllt3 A T 4: 87,840,781 S343R possibly damaging Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Mtrf1 C T 14: 79,411,650 H237Y probably damaging Het
Nckap1l T A 15: 103,473,056 L408Q probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr273 A G 4: 52,856,076 S146P possibly damaging Het
Olfr738 T G 14: 50,413,876 L111V possibly damaging Het
Otud7a T C 7: 63,735,915 S376P possibly damaging Het
Pabpc2 A T 18: 39,774,269 K196* probably null Het
Paqr8 T A 1: 20,935,413 C264S probably benign Het
Pgm2 T A 4: 99,981,979 F459Y probably benign Het
Phip C A 9: 82,908,869 V675L probably benign Het
Pnma1 T G 12: 84,147,723 T69P probably benign Het
Ptpn12 A T 5: 21,005,385 C242* probably null Het
Rabep1 T A 11: 70,908,468 V306E probably benign Het
Ros1 C T 10: 52,115,997 D1377N probably benign Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Scaf11 G A 15: 96,420,421 Q421* probably null Het
Shcbp1 G A 8: 4,744,512 T427M probably damaging Het
Shprh G A 10: 11,170,476 R979H probably damaging Het
Slc22a27 C T 19: 7,925,876 C163Y probably benign Het
Slc27a1 A G 8: 71,580,675 D287G probably damaging Het
Slc27a1 C T 8: 71,580,809 T310M possibly damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc35f2 A T 9: 53,771,785 M1L probably benign Het
Sltm G C 9: 70,581,365 R599T probably damaging Het
Spic T A 10: 88,675,890 Q168L probably damaging Het
Spink6 G A 18: 44,082,361 probably null Het
Stac2 T C 11: 98,041,372 E235G possibly damaging Het
Szt2 G A 4: 118,389,191 Q957* probably null Het
Them7 A T 2: 105,378,646 T104S possibly damaging Het
Tmed4 T A 11: 6,271,716 I207F possibly damaging Het
Tmem248 A G 5: 130,236,890 E178G probably benign Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Trim80 C A 11: 115,448,138 T598N possibly damaging Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Vil1 C T 1: 74,421,266 A194V probably damaging Het
Vmn2r61 A T 7: 42,267,141 M393L probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Vps33b G T 7: 80,290,048 A516S probably damaging Het
Wisp1 C A 15: 66,906,640 Y103* probably null Het
Zc3h6 G A 2: 129,002,240 G235R probably damaging Het
Zfp612 T A 8: 110,088,672 D170E probably benign Het
Zfp746 A G 6: 48,064,556 I412T probably benign Het
Other mutations in Chek2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Chek2 APN 5 110848670 missense probably damaging 1.00
IGL01830:Chek2 APN 5 110873508 missense probably benign
IGL01943:Chek2 APN 5 110841227 unclassified probably benign
IGL02319:Chek2 APN 5 110867011 missense possibly damaging 0.88
IGL03147:Chek2 UTSW 5 110848670 missense probably damaging 1.00
PIT4520001:Chek2 UTSW 5 110863329 missense probably damaging 1.00
R1484:Chek2 UTSW 5 110848687 missense probably damaging 1.00
R1486:Chek2 UTSW 5 110841227 unclassified probably benign
R1732:Chek2 UTSW 5 110872102 missense probably benign 0.26
R2041:Chek2 UTSW 5 110848664 missense probably damaging 1.00
R2071:Chek2 UTSW 5 110841246 unclassified probably benign
R2873:Chek2 UTSW 5 110863336 nonsense probably null
R2935:Chek2 UTSW 5 110868020 missense probably damaging 1.00
R3899:Chek2 UTSW 5 110865613 splice site probably benign
R4662:Chek2 UTSW 5 110867042 missense probably damaging 1.00
R5358:Chek2 UTSW 5 110841282 unclassified probably benign
R5582:Chek2 UTSW 5 110868035 missense probably damaging 0.96
R5594:Chek2 UTSW 5 110855834 critical splice donor site probably null
R6526:Chek2 UTSW 5 110848690 missense probably damaging 1.00
R6972:Chek2 UTSW 5 110855839 splice site probably null
R7232:Chek2 UTSW 5 110860915 missense probably damaging 1.00
R7338:Chek2 UTSW 5 110873514 missense probably benign
R7395:Chek2 UTSW 5 110872108 critical splice donor site probably null
R7714:Chek2 UTSW 5 110841453 missense probably benign 0.10
R7743:Chek2 UTSW 5 110840050 critical splice donor site probably null
R8290:Chek2 UTSW 5 110860900 missense possibly damaging 0.70
R8297:Chek2 UTSW 5 110848436 missense probably damaging 1.00
R8719:Chek2 UTSW 5 110867042 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGGCCGAGTTTGACATGG -3'
(R):5'- GTTACTATGCACAGGGTTACATAC -3'

Sequencing Primer
(F):5'- CCGAGTTTGACATGGTATGTTTC -3'
(R):5'- GTTCAGTGCTGTTTGACAG -3'
Posted On2015-11-11