Incidental Mutation 'R4748:Asprv1'
ID357287
Institutional Source Beutler Lab
Gene Symbol Asprv1
Ensembl Gene ENSMUSG00000033508
Gene Nameaspartic peptidase, retroviral-like 1
SynonymsTaps, SASPase, TPA-induced aspartic proteinase-like, SASP, 2300003P22Rik
MMRRC Submission 042030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4748 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86628164-86629710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86628423 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 84 (M84V)
Ref Sequence ENSEMBL: ENSMUSP00000046121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043400]
Predicted Effect probably damaging
Transcript: ENSMUST00000043400
AA Change: M84V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046121
Gene: ENSMUSG00000033508
AA Change: M84V

DomainStartEndE-ValueType
Pfam:Asp_protease 177 295 1.3e-8 PFAM
Pfam:Asp_protease_2 196 286 1.6e-10 PFAM
low complexity region 314 338 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele develop fine skin wrinkles at the side of their body without any apparent epidermal differentiation defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T A 1: 138,856,656 E54D possibly damaging Het
4933415F23Rik T C 1: 23,101,870 E121G probably damaging Het
Abcb6 C A 1: 75,177,358 G367W probably damaging Het
Aspscr1 T C 11: 120,701,507 V291A probably damaging Het
B4galnt4 T C 7: 141,071,720 F980L probably damaging Het
Bpi G A 2: 158,272,021 V280I possibly damaging Het
Bptf T C 11: 107,095,880 D581G probably damaging Het
Cap2 T A 13: 46,639,826 Y223N possibly damaging Het
Ccdc141 A C 2: 77,057,980 I480M possibly damaging Het
Ccnh T A 13: 85,189,639 V35E probably benign Het
Cd6 G T 19: 10,794,225 S433* probably null Het
Ceacam10 A C 7: 24,781,052 I83L probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Chia1 A T 3: 106,122,449 D73V probably damaging Het
Commd2 G A 3: 57,646,794 T162I probably benign Het
Creb3l3 C T 10: 81,086,047 A316T probably benign Het
Cul4a A G 8: 13,123,526 K1R probably benign Het
Cyp2c23 T C 19: 44,016,737 probably null Het
D630045J12Rik T C 6: 38,196,841 T131A possibly damaging Het
Dctn4 A C 18: 60,550,236 K295N probably damaging Het
Dnah1 A G 14: 31,319,945 V23A probably benign Het
Dync1i1 A G 6: 5,767,048 K91E possibly damaging Het
Dzip1l A G 9: 99,642,651 D275G probably damaging Het
Enam C A 5: 88,501,543 P304T probably damaging Het
Enpep A G 3: 129,332,163 Y107H probably damaging Het
Exd2 T C 12: 80,480,576 L27P probably damaging Het
Fam135b T A 15: 71,464,055 D430V probably benign Het
Fam222b C T 11: 78,154,603 T202I possibly damaging Het
Fmod T A 1: 134,041,174 N317K probably damaging Het
Frem2 A G 3: 53,541,093 F2301L probably damaging Het
Frem3 T C 8: 80,611,459 F127S probably damaging Het
Gbp7 A G 3: 142,538,087 S132G probably benign Het
Gm4787 A G 12: 81,378,056 C443R probably damaging Het
Grik2 T C 10: 49,535,341 M5V possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,555,333 L429F probably damaging Het
Lrr1 C A 12: 69,174,462 T126K probably benign Het
Mgat4e C A 1: 134,542,028 D93Y probably damaging Het
Mllt3 A T 4: 87,840,781 S343R possibly damaging Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Mtrf1 C T 14: 79,411,650 H237Y probably damaging Het
Nckap1l T A 15: 103,473,056 L408Q probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr1163 T A 2: 88,070,612 I257L probably benign Het
Olfr1238 C T 2: 89,406,255 V275I probably benign Het
Olfr273 A G 4: 52,856,076 S146P possibly damaging Het
Olfr738 T G 14: 50,413,876 L111V possibly damaging Het
Otud7a T C 7: 63,735,915 S376P possibly damaging Het
Pabpc2 A T 18: 39,774,269 K196* probably null Het
Paqr8 T A 1: 20,935,413 C264S probably benign Het
Pgm2 T A 4: 99,981,979 F459Y probably benign Het
Phip C A 9: 82,908,869 V675L probably benign Het
Pnma1 T G 12: 84,147,723 T69P probably benign Het
Ptpn12 A T 5: 21,005,385 C242* probably null Het
Rabep1 T A 11: 70,908,468 V306E probably benign Het
Ros1 C T 10: 52,115,997 D1377N probably benign Het
Ryr3 T C 2: 112,964,405 T121A possibly damaging Het
Scaf11 G A 15: 96,420,421 Q421* probably null Het
Shcbp1 G A 8: 4,744,512 T427M probably damaging Het
Shprh G A 10: 11,170,476 R979H probably damaging Het
Slc22a27 C T 19: 7,925,876 C163Y probably benign Het
Slc27a1 A G 8: 71,580,675 D287G probably damaging Het
Slc27a1 C T 8: 71,580,809 T310M possibly damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc35f2 A T 9: 53,771,785 M1L probably benign Het
Sltm G C 9: 70,581,365 R599T probably damaging Het
Spic T A 10: 88,675,890 Q168L probably damaging Het
Spink6 G A 18: 44,082,361 probably null Het
Stac2 T C 11: 98,041,372 E235G possibly damaging Het
Szt2 G A 4: 118,389,191 Q957* probably null Het
Them7 A T 2: 105,378,646 T104S possibly damaging Het
Tmed4 T A 11: 6,271,716 I207F possibly damaging Het
Tmem248 A G 5: 130,236,890 E178G probably benign Het
Tomm40l G A 1: 171,219,562 R296* probably null Het
Trim80 C A 11: 115,448,138 T598N possibly damaging Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Vil1 C T 1: 74,421,266 A194V probably damaging Het
Vmn2r61 A T 7: 42,267,141 M393L probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Vps33b G T 7: 80,290,048 A516S probably damaging Het
Wisp1 C A 15: 66,906,640 Y103* probably null Het
Zc3h6 G A 2: 129,002,240 G235R probably damaging Het
Zfp612 T A 8: 110,088,672 D170E probably benign Het
Zfp746 A G 6: 48,064,556 I412T probably benign Het
Other mutations in Asprv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Asprv1 APN 6 86628918 missense probably damaging 0.99
quince UTSW 6 86628840 missense probably damaging 1.00
R0254:Asprv1 UTSW 6 86629095 missense probably damaging 1.00
R0311:Asprv1 UTSW 6 86628840 missense probably damaging 1.00
R1538:Asprv1 UTSW 6 86628636 nonsense probably null
R1661:Asprv1 UTSW 6 86628736 missense probably damaging 0.97
R1792:Asprv1 UTSW 6 86628372 missense possibly damaging 0.59
R2964:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R2965:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R2966:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R5600:Asprv1 UTSW 6 86629062 nonsense probably null
R5655:Asprv1 UTSW 6 86628482 missense probably benign 0.05
R5704:Asprv1 UTSW 6 86628550 missense probably damaging 1.00
R5715:Asprv1 UTSW 6 86628614 missense probably benign
R6259:Asprv1 UTSW 6 86628379 missense probably benign 0.05
R6899:Asprv1 UTSW 6 86628760 missense probably damaging 1.00
R7451:Asprv1 UTSW 6 86628948 missense probably benign 0.00
R7593:Asprv1 UTSW 6 86628780 missense probably damaging 0.99
R7648:Asprv1 UTSW 6 86628870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGCCAGACACTTTGTAC -3'
(R):5'- AAACTGAAATCGCCCTGGG -3'

Sequencing Primer
(F):5'- AGACACTTTGTACCGGCTC -3'
(R):5'- CTGAGTCCATTGTAGACATCCAGG -3'
Posted On2015-11-11