Mutagenetix > Incidental Mutation

Incidental Mutation 'R4748:Grik2'

357308

Institutional Source

Beutler Lab

Gene Symbol

Grik2

Ensembl Gene

ENSMUSG00000056073

Gene Name

glutamate receptor, ionotropic, kainate 2 (beta 2)

Synonyms

Glurbeta2, Glur-6, Glur6

MMRRC Submission

042030-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4748 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49094833-49788766 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49535341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 5 (M5V)

Ref Sequence

ENSEMBL: ENSMUSP00000152029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218669] [ENSMUST00000218823] [ENSMUST00000220263]

AlphaFold

P39087

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079751
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: M234V

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105483
AA Change: M234V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000101123
Gene: ENSMUSG00000056073
AA Change: M234V

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	298	3e-11	PFAM
Pfam:ANF_receptor	52	334	3.5e-59	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105484
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: M234V

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105485
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: M234V

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105486
AA Change: M234V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: M234V

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	3.8e-11	PFAM
Pfam:ANF_receptor	52	395	1.5e-74	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	6e-13	BLAST
low complexity region	875	891	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105487
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: M234V

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218441
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000218598
AA Change: M234V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218669
AA Change: M5V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218823
AA Change: M234V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000220263
AA Change: M234V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310009B15Rik	T	A	1: 138,856,656	E54D	possibly damaging	Het
4933415F23Rik	T	C	1: 23,101,870	E121G	probably damaging	Het
Abcb6	C	A	1: 75,177,358	G367W	probably damaging	Het
Asprv1	A	G	6: 86,628,423	M84V	probably damaging	Het
Aspscr1	T	C	11: 120,701,507	V291A	probably damaging	Het
B4galnt4	T	C	7: 141,071,720	F980L	probably damaging	Het
Bpi	G	A	2: 158,272,021	V280I	possibly damaging	Het
Bptf	T	C	11: 107,095,880	D581G	probably damaging	Het
Cap2	T	A	13: 46,639,826	Y223N	possibly damaging	Het
Ccdc141	A	C	2: 77,057,980	I480M	possibly damaging	Het
Ccnh	T	A	13: 85,189,639	V35E	probably benign	Het
Cd6	G	T	19: 10,794,225	S433*	probably null	Het
Ceacam10	A	C	7: 24,781,052	I83L	probably benign	Het
Chek2	T	C	5: 110,855,839		probably null	Het
Chia1	A	T	3: 106,122,449	D73V	probably damaging	Het
Commd2	G	A	3: 57,646,794	T162I	probably benign	Het
Creb3l3	C	T	10: 81,086,047	A316T	probably benign	Het
Cul4a	A	G	8: 13,123,526	K1R	probably benign	Het
Cyp2c23	T	C	19: 44,016,737		probably null	Het
D630045J12Rik	T	C	6: 38,196,841	T131A	possibly damaging	Het
Dctn4	A	C	18: 60,550,236	K295N	probably damaging	Het
Dnah1	A	G	14: 31,319,945	V23A	probably benign	Het
Dync1i1	A	G	6: 5,767,048	K91E	possibly damaging	Het
Dzip1l	A	G	9: 99,642,651	D275G	probably damaging	Het
Enam	C	A	5: 88,501,543	P304T	probably damaging	Het
Enpep	A	G	3: 129,332,163	Y107H	probably damaging	Het
Exd2	T	C	12: 80,480,576	L27P	probably damaging	Het
Fam135b	T	A	15: 71,464,055	D430V	probably benign	Het
Fam222b	C	T	11: 78,154,603	T202I	possibly damaging	Het
Fmod	T	A	1: 134,041,174	N317K	probably damaging	Het
Frem2	A	G	3: 53,541,093	F2301L	probably damaging	Het
Frem3	T	C	8: 80,611,459	F127S	probably damaging	Het
Gbp7	A	G	3: 142,538,087	S132G	probably benign	Het
Gm4787	A	G	12: 81,378,056	C443R	probably damaging	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt90	G	A	15: 101,555,333	L429F	probably damaging	Het
Lrr1	C	A	12: 69,174,462	T126K	probably benign	Het
Mgat4e	C	A	1: 134,542,028	D93Y	probably damaging	Het
Mllt3	A	T	4: 87,840,781	S343R	possibly damaging	Het
Mms19	T	A	19: 41,944,558	S1031C	probably damaging	Het
Mtrf1	C	T	14: 79,411,650	H237Y	probably damaging	Het
Nckap1l	T	A	15: 103,473,056	L408Q	probably damaging	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr1163	T	A	2: 88,070,612	I257L	probably benign	Het
Olfr1238	C	T	2: 89,406,255	V275I	probably benign	Het
Olfr273	A	G	4: 52,856,076	S146P	possibly damaging	Het
Olfr738	T	G	14: 50,413,876	L111V	possibly damaging	Het
Otud7a	T	C	7: 63,735,915	S376P	possibly damaging	Het
Pabpc2	A	T	18: 39,774,269	K196*	probably null	Het
Paqr8	T	A	1: 20,935,413	C264S	probably benign	Het
Pgm2	T	A	4: 99,981,979	F459Y	probably benign	Het
Phip	C	A	9: 82,908,869	V675L	probably benign	Het
Pnma1	T	G	12: 84,147,723	T69P	probably benign	Het
Ptpn12	A	T	5: 21,005,385	C242*	probably null	Het
Rabep1	T	A	11: 70,908,468	V306E	probably benign	Het
Ros1	C	T	10: 52,115,997	D1377N	probably benign	Het
Ryr3	T	C	2: 112,964,405	T121A	possibly damaging	Het
Scaf11	G	A	15: 96,420,421	Q421*	probably null	Het
Shcbp1	G	A	8: 4,744,512	T427M	probably damaging	Het
Shprh	G	A	10: 11,170,476	R979H	probably damaging	Het
Slc22a27	C	T	19: 7,925,876	C163Y	probably benign	Het
Slc27a1	A	G	8: 71,580,675	D287G	probably damaging	Het
Slc27a1	C	T	8: 71,580,809	T310M	possibly damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc35f2	A	T	9: 53,771,785	M1L	probably benign	Het
Sltm	G	C	9: 70,581,365	R599T	probably damaging	Het
Spic	T	A	10: 88,675,890	Q168L	probably damaging	Het
Spink6	G	A	18: 44,082,361		probably null	Het
Stac2	T	C	11: 98,041,372	E235G	possibly damaging	Het
Szt2	G	A	4: 118,389,191	Q957*	probably null	Het
Them7	A	T	2: 105,378,646	T104S	possibly damaging	Het
Tmed4	T	A	11: 6,271,716	I207F	possibly damaging	Het
Tmem248	A	G	5: 130,236,890	E178G	probably benign	Het
Tomm40l	G	A	1: 171,219,562	R296*	probably null	Het
Trim80	C	A	11: 115,448,138	T598N	possibly damaging	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Vil1	C	T	1: 74,421,266	A194V	probably damaging	Het
Vmn2r61	A	T	7: 42,267,141	M393L	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Vps33b	G	T	7: 80,290,048	A516S	probably damaging	Het
Wisp1	C	A	15: 66,906,640	Y103*	probably null	Het
Zc3h6	G	A	2: 129,002,240	G235R	probably damaging	Het
Zfp612	T	A	8: 110,088,672	D170E	probably benign	Het
Zfp746	A	G	6: 48,064,556	I412T	probably benign	Het

Other mutations in Grik2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Grik2	APN	10	49355928	missense	possibly damaging	0.95
IGL00979:Grik2	APN	10	49355938	missense	probably damaging	1.00
IGL01012:Grik2	APN	10	49272956	missense	probably damaging	1.00
IGL01302:Grik2	APN	10	49244330	missense	probably damaging	0.99
IGL01657:Grik2	APN	10	49527986	critical splice donor site	probably null
IGL02162:Grik2	APN	10	49422575	missense	possibly damaging	0.77
IGL02317:Grik2	APN	10	49422615	missense	probably benign	0.16
IGL02512:Grik2	APN	10	49355912	missense	probably benign	0.00
IGL02650:Grik2	APN	10	49101235	missense	probably benign	0.03
IGL03283:Grik2	APN	10	49578269	missense	probably benign	0.00
BB004:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
BB014:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R0325:Grik2	UTSW	10	49240725	missense	probably damaging	1.00
R0492:Grik2	UTSW	10	49101164	missense	probably damaging	0.99
R0601:Grik2	UTSW	10	49422597	missense	probably damaging	1.00
R0844:Grik2	UTSW	10	49101115	missense	possibly damaging	0.81
R1333:Grik2	UTSW	10	49527991	missense	probably damaging	0.98
R1499:Grik2	UTSW	10	49132775	missense	probably damaging	1.00
R1660:Grik2	UTSW	10	49244343	nonsense	probably null
R1721:Grik2	UTSW	10	49523746	missense	possibly damaging	0.93
R1966:Grik2	UTSW	10	49355909	missense	probably damaging	1.00
R1974:Grik2	UTSW	10	49132827	missense	possibly damaging	0.85
R2246:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R3103:Grik2	UTSW	10	49240772	missense	probably damaging	1.00
R3974:Grik2	UTSW	10	49422654	missense	probably damaging	1.00
R4592:Grik2	UTSW	10	49422615	missense	possibly damaging	0.48
R4658:Grik2	UTSW	10	49523792	missense	possibly damaging	0.71
R4935:Grik2	UTSW	10	49240730	missense	probably damaging	1.00
R4977:Grik2	UTSW	10	49132745	missense	probably damaging	1.00
R5103:Grik2	UTSW	10	49496109	missense	probably benign	0.33
R5330:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5331:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5736:Grik2	UTSW	10	49404410	missense	probably damaging	0.96
R5740:Grik2	UTSW	10	49113477	missense	probably damaging	0.99
R5747:Grik2	UTSW	10	49523774	missense	probably benign
R6015:Grik2	UTSW	10	49523863	splice site	probably null
R6311:Grik2	UTSW	10	49578138	missense	probably damaging	0.98
R6474:Grik2	UTSW	10	49132680	missense	probably benign
R6504:Grik2	UTSW	10	49356102	missense	probably damaging	1.00
R6591:Grik2	UTSW	10	49272925	nonsense	probably null
R6691:Grik2	UTSW	10	49272925	nonsense	probably null
R6776:Grik2	UTSW	10	49355989	missense	probably damaging	1.00
R7015:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R7094:Grik2	UTSW	10	49355916	missense	possibly damaging	0.75
R7153:Grik2	UTSW	10	49535367	missense	probably benign	0.00
R7229:Grik2	UTSW	10	49101416	splice site	probably null
R7402:Grik2	UTSW	10	49535397	missense	probably damaging	1.00
R7473:Grik2	UTSW	10	49113522	missense	probably benign	0.22
R7514:Grik2	UTSW	10	49523808	missense	probably damaging	0.99
R7526:Grik2	UTSW	10	49523822	missense	possibly damaging	0.56
R7657:Grik2	UTSW	10	49783151	missense	probably benign	0.11
R7681:Grik2	UTSW	10	49244380	missense	probably damaging	1.00
R7714:Grik2	UTSW	10	49419696	missense	probably damaging	0.97
R7927:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R7952:Grik2	UTSW	10	49422537	missense	probably benign	0.15
R7979:Grik2	UTSW	10	49404342	missense	probably benign	0.01
R8062:Grik2	UTSW	10	49240767	missense	probably damaging	1.00
R8222:Grik2	UTSW	10	49573648	missense	probably benign	0.29
R8406:Grik2	UTSW	10	49272767	missense	probably damaging	1.00
R9017:Grik2	UTSW	10	49113459	missense	possibly damaging	0.94
RF008:Grik2	UTSW	10	49244384	missense	probably damaging	1.00
X0062:Grik2	UTSW	10	49272920	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCAATATGTTATTCCTGGGC -3'
(R):5'- ATGAGCTACTCTAATTTGCTTCCAC -3'

Sequencing Primer
(F):5'- CCTCATCCTAAATCTTGTTAAAGACC -3'
(R):5'- GCTCATCAAAGCTCCATC -3'

Posted On

2015-11-11